alpha Defensin 1 (DEFA1) (NM_004084) Human Untagged Clone

CAT#: SC117582

DEFA1 (untagged)-Human defensin, alpha 1 (DEFA1)



  "NM_004084" in other vectors (6)

CNY 1,200.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-DEFA1/3 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms DEF1; DEFA2; HNP-1; HP-1; HP1; MRS
Vector pCMV6-XL4
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF within SC117582 sequence for NM_004084 edited (data generated by NextGen Sequencing)
ATGAGGACCCTCGCCATCCTTGCTGCCATTCTCCTGGTGGCCCTGCAGGCCCAGGCTGAG
CCACTCCAGGCAAGAGCTGATGAGGTTGCTGCAGCCCCGGAGCAGATTGCAGCGGACATC
CCAGAAGTGGTTGTTTCCCTTGCATGGGACGAAAGCTTGGCTCCAAAGCATCCAGGCTCA
AGGAAAAACATGGCCTGCTATTGCAGAATACCAGCGTGCATTGCAGGAGAACGTCGCTAT
GGAACCTGCATCTACCAGGGAAGACTCTGGGCATTCTGCTGCTGA

Clone variation with respect to NM_004084.3
>OriGene 5' read for NM_004084 unedited
TATAGGCGGCCGCGACATCGGCACCAGTGCCCTCTCTGGTCACCCTGCCTAGCTAGAGGA
TCTGTGACCCCAGCCATGAGGACCCTCGCCATCCTTGCTGCCATTCTCCTGGTGGCCCTG
CAGGCCCAGGCTGAGCCACTCCAGGCAAGAGCTGATGAGGTTGCTGCAGCCCCGGAGCAG
CTTGCAGCGGACATCCCAGAAGTGGTTGTTTCCCTTGCATGGGACGAAAAGCTTGGCTCC
AAAGCATCCAGGCTCAAGGAAAACATGGACTGCTATTGCAGAATACCAGCGTGCATTGCA
GGAGAACGTCGCTATGGAACCTGCATCTACCAAGGGAAGACTCTGGGCATTCTGCTGCTG
AGCTTGCAGAAAAAGAAAAATGAAGCTCAAAATTTGCTTTGAGAGCTACAGGGAATTGCT
ATTACTCCTGTACCTTCTGCTCAATTTCCTTTCCTTATCTCAAATAAATGCCTTGTTACA
AAAAN
Restriction Sites NotI-NotI     
ACCN NM_004084
Insert Size 680 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_004084.2, NP_004075.1
RefSeq Size 490 bp
RefSeq ORF 285 bp
Locus ID 1667
UniProt ID P59665
Domains Defensin_propep, DEFSN, defensins
Protein Families Druggable Genome, Secreted Protein
Gene Summary Defensins are a family of antimicrobial and cytotoxic peptides thought to be involved in host defense. They are abundant in the granules of neutrophils and also found in the epithelia of mucosal surfaces such as those of the intestine, respiratory tract, urinary tract, and vagina. Members of the defensin family are highly similar in protein sequence and distinguished by a conserved cysteine motif. The protein encoded by this gene, defensin, alpha 1, is found in the microbicidal granules of neutrophils and likely plays a role in phagocyte-mediated host defense. Several alpha defensin genes are clustered on chromosome 8. This gene differs from defensin, alpha 3 by only one amino acid. This gene and the gene encoding defensin, alpha 3 are both subject to copy number variation. [provided by RefSeq, Oct 2014]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...