GNGT2 (BC008663) Human Untagged Clone

CAT#: SC125924

GNGT2 (untagged)-Human guanine nucleotide binding protein (G protein), gamma transducing activity polypeptide 2 (cDNA clone MGC:17691 IMAGE:3866242), complete cds



CNY 4,352.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


GNGT2 rabbit polyclonal antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms G-GAMMA-8; G-GAMMA-C; gamma-T2 subunit; GNG8; GNG9; GNGT8; G protein cone gamma 8 subunit; guanine nucleotide binding protein (G prote; guanine nucleotide binding protein-gamma transducing activity polypeptide 2; guanine nucleotide binding protein gamma 9
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for BC008663 edited
TGAAGAGTGAGCTAGGAGAACTTCGTAAGGTGAAACTGTGGGGATCCAATGGGCAACACA
AAGCATCTTGGTTAAGGAGGTTAGGGGCCGGTCTAGGACTTGCCTCAGGAGGAAGGACAG
CCTCAGAGCATGCTCAGAGGTGGGAAGGGAAGGAGGAGAAAGCAGGCGAAGCGGGGCCAT
CTGCTTTATCTGAAGATTTTCAGCTGATGAAGAACTAGGAGGCTCAAACACTATCTTACC
TGAGTCCAGGACAAGTGACTTGGAGAGTGTGCTCTTCTGTGGCAGGATCAGGTCTGTCTA
GGGCAGGATGGCCCAGGATCTCAGCGAGAAGGACCTGTTGAAGATGGAGGTGGAGCAGCT
GAAGAAAGAAGTGAAAAACACAAGAATTCCGATTTCCAAAGCGGGAAAGGAAATCAAGGA
GTACGTGGAGGCCCAAGCAGGAAACGATCCTTTTCTCAAAGGCATCCCTGAGGACAAGAA
TCCCTTCAAGGAGAAAGGTGGCTGTCTGATAAGCTGATGGCATGGAGCCCTGCCCTGAGT
GTCTGTCCCTCTTCAGCCAAGCCCAAGTCTCCTAGACCCCCAGGGAGCCAGTGAACTGTC
ACCTTCTCTTCATCACAGAATGAGTAAAGATCCCTGAACAAATGCAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN BC008663
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq BC008663.1, AAH08663.1
RefSeq Size 660 bp
Locus ID 2793
Protein Families Druggable Genome
Protein Pathways Chemokine signaling pathway
Gene Summary Phototransduction in rod and cone photoreceptors is regulated by groups of signaling proteins. The encoded protein is thought to play a crucial role in cone phototransduction. It belongs to the G protein gamma family and localized specifically in cones. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Nov 2010]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Customer Reviews 
Loading...