Pancreatic Polypeptide (PPY) (BC032225) Human Untagged Clone

CAT#: SC126039

PPY (untagged)-Human pancreatic polypeptide (cDNA clone MGC:34568 IMAGE:5229163), complete cds



CNY 6,776.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


PPY mouse monoclonal antibody,clone OTI1G2
    • 100 ul

CNY 1,999.00
CNY 3,490.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms PNP; PP
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for BC032225 edited
ATGGCTGCCGCACGCCTCTGCCTCTCCCTGCTGCTCCTGTCCACCTGCGTGGCTCTGTTA
CTACAGCCACTGCTGGGTGCCCAGGGAGCCCCACTGGAGCCAGTGTACCCAGGGGACAAT
GCCACACCAGAGCAGATGGCCCAGTATGCAGCTGATCTCCGTAGATACATCAACATGCTG
ACCAGGCCTAGGTATGGGAAAAGACACAAAGAGGACACGCTGGCCTTCTCGGAGTGGGGG
TCCCCGCATGCTGCTGTCCCCAGGGAGCTCAGCCCGCTGGACTTATAATGCCACCTTCTG
TCTCCTACGACTCCATGAGCAGCGCCAGCCCAGCTCTCCCCTCTGCACCCTTGGCTCTGG
CCAAAGCTTGCTCCCTGCTCCCACACAGGCTCAATAAAGCAAGTCAAAGCCAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
AAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAA
Restriction Sites Please inquire     
ACCN BC032225
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq BC032225.2, AAH32225.1
RefSeq Size 527 bp
Locus ID 5539
Protein Families Secreted Protein
Gene Summary This gene encodes a member of the neuropeptide Y (NPY) family of peptides. The encoded 95 aa preproprotein is synthesized in the pancreatic islets of Langerhans and proteolytically processed to generate two peptide products. These products include the active pancreatic hormone of 36 aa and an icosapeptide of unknown function. This hormone acts as a regulator of pancreatic and gastrointestinal functions and may be important in the regulation of food intake. Plasma level of this hormone has been shown to be reduced in conditions associated with increased food intake and elevated in anorexia nervosa. In addition, infusion of this hormone in obese rodents has shown to decrease weight gain. Alternative splicing results in multiple transcript variants, at least one of which encodes an isoform that is proteolytically processed. [provided by RefSeq, Jan 2016]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.
Customer Reviews 
Loading...