UBE2D2 (NM_181838) Human Untagged Clone

CAT#: SC127401

UBE2D2 (untagged)-Human ubiquitin-conjugating enzyme E2D 2 (UBE2D2), transcript variant 2



  "NM_181838" in other vectors (4)

CNY 1,200.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
UBE2D2 mouse monoclonal antibody, clone OTI2C2 (formerly 2C2)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms E2(17)KB2; PUBC1; UBC4; UBC4/5; UBCH4; UBCH5B
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_181838 edited
AAGAGAATCCACAAGGAATTGAATGATCTGGCACGGGACCCTCCAGCACAGTGTTCAGCA
GGTCCTGTTGGAGATGATATGTTCCATTGGCAAGCTACAATAATGGGGCCAAATGACAGT
CCCTATCAGGGTGGAGTATTTTTCTTGACAATTCATTTCCCAACAGATTACCCCTTCAAA
CCACCTAAGGTTGCATTTACAACAAGAATTTATCATCCAAATATTAACAGTAATGGCAGC
ATTTGTCTTGATATTCTACGATCACAGTGGTCTCCAGCACTAACTATTTCAAAAGTACTC
TTGTCCATCTGTTCTCTGTTGTGTGATCCCAATCCAGATGATCCTTTAGTGCCTGAGATT
GCTCGGATCTACAAAACAGATAGAGAAAAGTACAACAGAATAGCTCGGGAATGGACTCAG
AAGTATGCGATGTAATTAAAGAAATTATTGGATAACCTCTACAAATAAAGATAGGGGGAA
CTCTGAAAGAGAAAGTCCTTTTGATTTCCATTTGACTGCTTTCTATGAGCCCACGCCTCA
TCTT
>OriGene 5' read for NM_181838 unedited
AAACCACCTAAGGTTGCATTTACAACAAGAATTTATTCATCCAAATATTAACAGTAATGG
CAGCATTTGTCTTGATATTCTACGATCACAGTGGTCTCCAGCACTAACTATTTCAAAAGT
ACTCTTGTCCATCTGTTCTCTGTTGTGTGATCCCAATCCAGATGATCCTTTAGTGCCTGA
GATTGCTCGGATCTACAAAACAGATAGAGAAAAGTACAACAGAATAGCTCGGGAATGGAC
TCAGAAGTATGCGATGTAATTAAAGAAATTATTGGATAACCTCTACAAATAAAGATAGGN
GGAACTCTGNAAGAGAAAGTCCTTTTGATTTCCATTTGACTGCTTTCTATGAGCCCACGC
CTCATCTTCCCCTGTGCACATGTTTTACCT
Restriction Sites NotI-NotI     
ACCN NM_181838
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_181838.1, NP_862821.1
RefSeq Size 2879 bp
RefSeq ORF 357 bp
Locus ID 7322
UniProt ID P62837
Protein Pathways Ubiquitin mediated proteolysis
Gene Summary Regulated degradation of misfolded, damaged or short-lived proteins in eukaryotes occurs via the ubiquitin (Ub)-proteasome system (UPS). An integral part of the UPS system is the ubiquitination of target proteins and covalent linkage of Ub-containing proteins to form polymeric chains, marking them as targets for 26S proteasome-mediated degradation. Ubiquitination of proteins is mediated by a cascade of enzymes which includes E1 (ubiquitin activating), E2 (ubiquitin conjugating), and E3 (ubiquitin ligases) enzymes. This gene encodes a member of the E2 enzyme family. Substrates of this enzyme include the tumor suppressor protein p53 and peroxisomal biogenesis factor 5 (PEX5). Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, May 2013]
Transcript Variant: This variant (2) contains an alternate exon in the 5' region, differs in the 5' UTR and initiates translation at a downstream start codon, compared to variant 1. It encodes isoform 2 which is shorter at the N-terminus compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...