hCG beta (CGB3) (NM_000737) Human Untagged Clone
CAT#: SC300128
CGB (untagged)-Human chorionic gonadotropin, beta polypeptide (CGB)
CNY 1,800.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CGB; CGB5; CGB7; CGB8; hCGB; LHB |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_000737 edited
GCCTCCTCCTGGCTTCCAAGACCCCACCATAGGCAGAGGCAGGCCTTCCTACACCCTACT CCCTGTGCCTCCAGCCTCGACTAGTCCCTAGCACTCGACGACTGAGTCTCTGAGGTCACT TCACCGTGGTCTCCGCCTCACCCTTGGCGCTGGACCACTGAGGGGAGAGGGCTGGGGCGC TCCGCTGAGCCACTCCTGAGCCCCCCTGGCCTTGTCTACCTCTTGCCCCCCAAGGGGTTA GTGTCGAGCTCACCCCAGCATCCTACCACCTCCTGGTGGCCTTGCCGCCCCCACAACCCC GAGGTATAAAGCCAGGTACACGAGGCAGGGGACGCACCAAGGATGGAGATGTTCCAGGGG CTGCTGCTGTTGCTGCTGCTGAGCATGGGCGGGACATGGGCATCCAAGGAGCCGCTTCGG CCACGGTGCCGCCCCATCAATGCCACCCTGGCTGTGGAGAAGGAGGGCTGCCCCGTGTGC ATCACCGTCAACACCACCATCTGTGCCGGCTACTGCCCCACCATGACCCGCGTGCTGCAG GGGGTCCTGCCGGCCCTGCCTCAGGTGGTGTGCAACTACCGCGATGTGCGCTTCGAGTCC ATCCGGCTCCCTGGCTGCCCGCGCGGCGTGAACCCCGTGGTCTCCTACGCCGTGGCTCTC AGCTGTCAATGTGCACTCTGCCGCCGCAGCACCACTGACTGCGGGGGTCCCAAGGACCAC CCCTTGACCTGTGATGACCCCCGCTTCCAGGACTCCTCTTCCTCAAAGGCCCCTCCCCCG AGCCTTCCAAGTCCATCCCGACTCCCGGGGCCCTCGGACACCCCGATCCTCCCACAATAA AGGCTTCTCAATCCGCAAAAAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_000737 |
Insert Size | 900 bp |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_000737.2. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_000737.2, NP_000728.1 |
RefSeq Size | 879 bp |
RefSeq ORF | 498 bp |
Locus ID | 1082 |
UniProt ID | P01233 |
Protein Families | Druggable Genome |
Gene Summary | This gene is a member of the glycoprotein hormone beta chain family and encodes the beta 3 subunit of chorionic gonadotropin (CG). Glycoprotein hormones are heterodimers consisting of a common alpha subunit and an unique beta subunit which confers biological specificity. CG is produced by the trophoblastic cells of the placenta and stimulates the ovaries to synthesize the steroids that are essential for the maintenance of pregnancy. The beta subunit of CG is encoded by 6 genes which are arranged in tandem and inverted pairs on chromosome 19q13.3 and contiguous with the luteinizing hormone beta subunit gene. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC217234 | CGB (Myc-DDK-tagged)-Human chorionic gonadotropin, beta polypeptide (CGB) |
CNY 1,800.00 |
|
RC217234L3 | Lenti-ORF clone of CGB (Myc-DDK-tagged)-Human chorionic gonadotropin, beta polypeptide (CGB) |
CNY 5,890.00 |
|
RC217234L4 | Lenti-ORF clone of CGB (mGFP-tagged)-Human chorionic gonadotropin, beta polypeptide (CGB) |
CNY 5,890.00 |
|
RG217234 | CGB (tGFP-tagged) - Human chorionic gonadotropin, beta polypeptide (CGB) |
CNY 4,370.00 |
其它hCG beta产品