beta 1 Sodium Potassium ATPase (ATP1B1) (NM_001001787) Human Untagged Clone
CAT#: SC300306
ATP1B1 (untagged)-Human ATPase, Na+/K+ transporting, beta 1 polypeptide (ATP1B1), transcript variant 2
CNY 2,400.00
CNY 6,270.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ATP1B; MGC1798 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_001001787 edited
CAGCGGCAGCGGCGCGTCCTGCCTGCAGAGAGCCAGGCCGGAGAAGCCGAGCGGCGCAGA GGACGCCAGGGCGCGCGCCGCAGCCACCCACCCTCCGGACCGCGGCAGCTGCTGACCCGC CATCGCCATGGCCCGCGGGAAAGCCAAGGAGGAGGGCAGCTGGAAGAAATTCATCTGGAA CTCAGAGAAGAAGGAGTTTCTGGGCAGGACCGGTGGCAGTTGGTTTAAGATCCTTCTATT CTACGTAATATTTTATGGCTGCCTGGCTGGCATCTTCATCGGAACCATCCAAGTGATGCT GCTCACCATCAGTGAATTTAAGCCCACATATCAGGACCGAGTGGCCCCGCCAGGATTAAC ACAGATTCCTCAGATCCAGAAGACTGAAATTTCCTTTCGTCCTAATGATCCCAAGAGCTA TGAGGCATATGTACTGAACATAGTTAGGTTCCTGGAAAAGTACAAAGATTCAGCCCAGAG GGATGACATGATTTTTGAAGATTGTGGCGATGTGCCCAGTGAACCGAAAGAACGAGGAGA CTTTAATCATGAACGAGGAGAGCGAAAGGTCTGCAGATTCAAGCTTGAATGGCTGGGAAA TTGCTCTGGATTAAATGATGAAACTTATGGCTACAAAGAGGGCAAACCGTGCATTATTAT AAAGCTCAACCGAGTTCTAGGCTTCAAACCTAAGCCTCCCAAGAATGAGTCCTTGGAGAC TTACCCAGTGATGAAGTATAACCCAAATGTCCTTCCCGTTCAGTGCACTGGCAAGCGAGA TGAAGATAAGGATAAAGTTGGAAATGTGGAGTATTTTGGACTGGGCAACTCCCCTGGTTT TCCTCTGCAGTATTATCCGTACTATGGCAAACTCCTGCAGCCCAAATACCTGCAGCCCCT GCTGGCCGTACAGTTCACCAATCTTACCATGGACACTGAAATTCGCATAGAGTGTAAGGC GTACGGTGAGAACATTGGGTACAGTGAGAAAGACCGTTTTCAGGGACGTTTTGATGTAAA AATTAAATTTTAA |
Restriction Sites | Please inquire |
ACCN | NM_001001787 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001001787.1, NP_001001787.1 |
RefSeq Size | 1568 bp |
RefSeq ORF | 906 bp |
Locus ID | 481 |
Protein Families | Transmembrane |
Protein Pathways | Cardiac muscle contraction |
Gene Summary | The protein encoded by this gene belongs to the family of Na+/K+ and H+/K+ ATPases beta chain proteins, and to the subfamily of Na+/K+ -ATPases. Na+/K+ -ATPase is an integral membrane protein responsible for establishing and maintaining the electrochemical gradients of Na and K ions across the plasma membrane. These gradients are essential for osmoregulation, for sodium-coupled transport of a variety of organic and inorganic molecules, and for electrical excitability of nerve and muscle. This enzyme is composed of two subunits, a large catalytic subunit (alpha) and a smaller glycoprotein subunit (beta). The beta subunit regulates, through assembly of alpha/beta heterodimers, the number of sodium pumps transported to the plasma membrane. The glycoprotein subunit of Na+/K+ -ATPase is encoded by multiple genes. This gene encodes a beta 1 subunit. Alternatively spliced transcript variants encoding different isoforms have been described, but their biological validity is not known. [provided by RefSeq, Mar 2010] Transcript Variant: This variant (2) lacks a segment in the coding region, which leads to a frameshift, compared to variant 1. The resulting isoform (b) contains a shorter and distinct C-terminus compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC219880 | ATP1B1 (Myc-DDK-tagged)-Human ATPase, Na+/K+ transporting, beta 1 polypeptide (ATP1B1), transcript variant 2 |
CNY 2,400.00 |
|
RC219880L3 | Lenti ORF clone of Human ATPase, Na+/K+ transporting, beta 1 polypeptide (ATP1B1), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC219880L4 | Lenti ORF clone of Human ATPase, Na+/K+ transporting, beta 1 polypeptide (ATP1B1), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG219880 | ATP1B1 (tGFP-tagged) - Human ATPase, Na+/K+ transporting, beta 1 polypeptide (ATP1B1), transcript variant 2 |
CNY 4,000.00 |
其它beta 1 Sodium Potassium ATPase产品