Sumo 2 (SUMO2) (NM_001005849) Human Untagged Clone
CAT#: SC301039
SUMO2 (untagged)-Human SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae) (SUMO2), transcript variant 2
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | HSMT3; Smt3A; SMT3B; SMT3H2; SUMO3 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC301039 representing NM_001005849.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCCGACGAAAAGCCCAAGGAAGGAGTCAAGACTGAGAACAACGATCATATTAATTTGAAGGTGGCG GGGCAGGATGGTTCTGTGGTGCAGTTTAAGATTAAGAGGCATACACCACTTAGTAAACTAATGAAAGCC TATTGTGAACGACAGTTGGAAATGGAGGATGAAGATACAATTGATGTGTTCCAACAGCAGACGGGAGGT GTCTACTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001005849 |
Insert Size | 216 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001005849.1 |
RefSeq Size | 994 bp |
RefSeq ORF | 216 bp |
Locus ID | 6613 |
UniProt ID | P61956 |
Protein Families | Druggable Genome |
MW | 8.1 kDa |
Gene Summary | This gene encodes a protein that is a member of the SUMO (small ubiquitin-like modifier) protein family. It functions in a manner similar to ubiquitin in that it is bound to target proteins as part of a post-translational modification system. However, unlike ubiquitin which targets proteins for degradation, this protein is involved in a variety of cellular processes, such as nuclear transport, transcriptional regulation, apoptosis, and protein stability. It is not active until the last two amino acids of the carboxy-terminus have been cleaved off. Numerous pseudogenes have been reported for this gene. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) lacks an in-frame coding exon compared to variant 1, resulting in a shorter isoform (b), compared to isoform a. The amino acid sequence of isoform b is predicted and has not been experimentally verified. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC222664 | SUMO2 (Myc-DDK-tagged)-Human SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae) (SUMO2), transcript variant 2 |
CNY 1,200.00 |
|
RC222664L1 | Lenti ORF clone of Human SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae) (SUMO2), transcript variant 2, Myc-DDK-tagged |
CNY 3,600.00 |
|
RC222664L2 | Lenti ORF clone of Human SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae) (SUMO2), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RC222664L3 | Lenti ORF clone of Human SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae) (SUMO2), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC222664L4 | Lenti ORF clone of Human SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae) (SUMO2), transcript variant 2, mGFP tagged |
CNY 3,600.00 |
|
RG222664 | SUMO2 (tGFP-tagged) - Human SMT3 suppressor of mif two 3 homolog 2 (S. cerevisiae) (SUMO2), transcript variant 2 |
CNY 4,370.00 |