ErbB 3 (ERBB3) (NM_001005915) Human Untagged Clone
CAT#: SC301052
ERBB3 (untagged)-Human v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian) (ERBB3), transcript variant s
CNY 2,400.00
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | c-erbB-3; c-erbB3; ErbB-3; erbB3-S; FERLK; HER3; LCCS2; MDA-BF-1; p45-sErbB3; p85-sErbB3; p180-ErbB3 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_001005915 edited
ATGAGGGCGAACGACGCTCTGCAGGTGCTGGGCTTGCTTTTCAGCCTGGCCCGGGGCTCC GAGGTGGGCAACTCTCAGGCAGTGTGTCCTGGGACTCTGAATGGCCTGAGTGTGACCGGC GATGCTGAGAACCAATACCAGACACTGTACAAGCTCTACGAGAGGTGTGAGGTGGTGATG GGGAACCTTGAGATTGTGCTCACGGGACACAATGCCGACCTCTCCTTCCTGCAGTGGATT CGAGAAGTGACAGGCTATGTCCTCGTGGCCATGAATGAATTCTCTACTCTACCATTGCCC AACCTCCGCGTGGTGCGAGGGACCCAGGTCTACGATGGGAAGTTTGCCATCTTCGTCATG TTGAACTATAACACCAACTCCAGCCACGCTCTGCGCCAGCTCCGCTTGACTCAGCTCACC GGTCAGTTCCCGATGGTTCCTTCTGGCCTCACCCCTCAGCCAGCCCAAGACTGGTACCTC CTTGATGATGACCCAAGACTGCTCACTCTAAGTGCCTCTTCCAAGGTGCCTGTCACCTTG GCCGCTGTCTAA |
Restriction Sites | Please inquire |
ACCN | NM_001005915 |
Insert Size | 600 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001005915.1, NP_001005915.1 |
RefSeq Size | 1050 bp |
RefSeq ORF | 552 bp |
Locus ID | 2065 |
UniProt ID | P21860 |
Protein Families | Adult stem cells, Druggable Genome, Protein Kinase, Secreted Protein, Stem cell - Pluripotency, Transmembrane |
Protein Pathways | Calcium signaling pathway, Endocytosis, ErbB signaling pathway |
Gene Summary | This gene encodes a member of the epidermal growth factor receptor (EGFR) family of receptor tyrosine kinases. This membrane-bound protein has a neuregulin binding domain but not an active kinase domain. It therefore can bind this ligand but not convey the signal into the cell through protein phosphorylation. However, it does form heterodimers with other EGF receptor family members which do have kinase activity. Heterodimerization leads to the activation of pathways which lead to cell proliferation or differentiation. Amplification of this gene and/or overexpression of its protein have been reported in numerous cancers, including prostate, bladder, and breast tumors. Alternate transcriptional splice variants encoding different isoforms have been characterized. One isoform lacks the intermembrane region and is secreted outside the cell. This form acts to modulate the activity of the membrane-bound form. Additional splice variants have also been reported, but they have not been thoroughly characterized. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (s) lacks many 3' exons found in variant 1 and contains an alternate 3' exon of its own, that causes a frameshift. The resulting isoform (s) is shorter lacking the intermembrane region present in isoform 1, and is secreted outside the cell. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC224398 | ERBB3 (Myc-DDK-tagged)-Human v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian) (ERBB3), transcript variant s |
CNY 2,400.00 |
|
RC224398L1 | Lenti ORF clone of Human v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian) (ERBB3), transcript variant s, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC224398L2 | Lenti ORF clone of Human v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian) (ERBB3), transcript variant s, mGFP tagged |
CNY 5,890.00 |
|
RC224398L3 | Lenti ORF clone of Human v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian) (ERBB3), transcript variant s, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC224398L4 | Lenti ORF clone of Human v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian) (ERBB3), transcript variant s, mGFP tagged |
CNY 5,890.00 |
|
RC600007 | ERBB3 (DDK-His-tagged)-Extra Cellular Domain Clone of Homo sapiens v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian), transcript variant s, Signal peptide (1-19) plus EC domain (20-183) |
CNY 2,400.00 |
|
RG224398 | ERBB3 (tGFP-tagged) - Human v-erb-b2 erythroblastic leukemia viral oncogene homolog 3 (avian) (ERBB3), transcript variant s |
CNY 4,370.00 |