SHISA2 (NM_001007538) Human Untagged Clone
CAT#: SC301233
SHISA2 (untagged)-Human shisa homolog 2 (Xenopus laevis) (SHISA2)
CNY 6,270.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | bA398O19.2; C13orf13; hShisa; PRO28631; TMEM46; WGAR9166 |
Vector | pCMV6-XL6 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_001007538 edited
ATGTGGGGCGCTCGCCGCTCGTCCGTCTCCTCATCCTGGAACGCCGCTTCGCTCCTGCAG CTGCTGCTGGCTGCGCTGCTGGCGGCGGGGGCGAGGGCCAGCGGCGAGTACTGCCACGGC TGGCTGGACGCGCAGGGCGTCTGGCGCATCGGCTTCCAGTGTCCCGAGCGCTTCGACGGC GGCGACGCCACCATCTGCTGCGGCAGCTGCGCGTTGCGCTACTGCTGCTCCAGCGCCGAG GCGCGCCTGGACCAGGGCGGCTGCGACAATGACCGCCAGCAGGGCGCTGGCGAGCCTGGC CGGGCGGACAAAGACGGCCCCGACGGCTCGGCAGTGCCCATCTACGTGCCGTTCCTCATT GTTGGCTCCGTGTTTGTCGCCTTTATCATCTTGGGGTCCCTGGTGGCAGCCTGTTGCTGC AGATGTCTCCGGCCTAAGCAGGATCCCCAGCAGAGCCGAGCCCCAGGGGGTAACCGCTTG ATGGAGACCATCCCCATGATCCCCAGTGCCAGCACCTCCCGGGGGTCGTCCTCACGCCAG TCCAGCACAGCTGCCAGTTCCAGCTCCAGCGCCAACTCAGGGGCCCGGGCGCCCCCAACA AGGTCACAGACCAACTGTTGCTTGCCGGAAGGGACCATGAACAACGTGTATGTCAACATG CCCACGAATTTCTCTGTGCTGAACTGTCAGCAGGCCACCCAGATTGTGCCACATCAAGGG CAGTATCTGCATCCCCCATACGTGGGGTACACGGTGCAGCACGACTCTGTGCCCATGACA GCTGTGCCACCTTTCATGGACGGCCTGCAGCCTGGCTACAGGCAGATTCAGTCCCCCTTC CCTCACACCAACAGTGAACAGAAGATGTACCCAGCGGTGACTGTATAA |
Restriction Sites | Please inquire |
ACCN | NM_001007538 |
Insert Size | 1800 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001007538.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001007538.1, NP_001007539.1 |
RefSeq Size | 2889 bp |
RefSeq ORF | 888 bp |
Locus ID | 387914 |
UniProt ID | Q6UWI4 |
Protein Families | Transmembrane |
Gene Summary | Plays an essential role in the maturation of presomitic mesoderm cells by individual attenuation of both FGF and WNT signaling.[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC220414 | SHISA2 (Myc-DDK-tagged)-Human shisa homolog 2 (Xenopus laevis) (SHISA2) |
CNY 2,400.00 |
|
RC220414L1 | Lenti ORF clone of Human shisa homolog 2 (Xenopus laevis) (SHISA2), Myc-DDK-tagged |
CNY 4,800.00 |
|
RC220414L2 | Lenti ORF clone of Human shisa homolog 2 (Xenopus laevis) (SHISA2), mGFP tagged |
CNY 5,890.00 |
|
RC220414L3 | Lenti ORF clone of Human shisa homolog 2 (Xenopus laevis) (SHISA2), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC220414L4 | Lenti ORF clone of Human shisa homolog 2 (Xenopus laevis) (SHISA2), mGFP tagged |
CNY 5,890.00 |
|
RG220414 | SHISA2 (tGFP-tagged) - Human shisa homolog 2 (Xenopus laevis) (SHISA2) |
CNY 4,370.00 |