Septin 2 (SEPT2) (NM_001008491) Human Untagged Clone
CAT#: SC301304
41519 (untagged)-Human septin 2 (SEPT2), transcript variant 1
CNY 7,220.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DIFF6; hNedd5; NEDD-5; NEDD5; Pnutl3; SEPT2 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC301304 representing NM_001008491.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCTAAGCAACAGCCAACTCAGTTTATAAATCCAGAAACACCTGGCTATGTTGGATTTGCAAACCTC CCCAATCAAGTTCACCGAAAATCAGTGAAAAAAGGTTTTGAGTTCACACTGATGGTGGTCGGTGAATCA GGTCTAGGAAAATCGACTCTCATAAACAGCCTATTCCTAACTGATCTGTACCCAGAAAGAGTCATACCT GGAGCAGCAGAAAAAATTGAAAGAACTGTCCAGATTGAGGCTTCAACTGTTGAAATTGAAGAGCGAGGG GTCAAGCTACGCCTGACAGTGGTAGATACCCCTGGCTATGGTGACGCTATCAACTGCAGAGATTGTTTT AAGACAATTATCTCCTATATTGATGAGCAATTTGAGAGGTACCTGCATGACGAGAGCGGCTTGAACAGG CGGCACATCATTGATAATAGGGTGCATTGTTGCTTTTACTTTATTTCACCTTTTGGACATGGACTTAAG CCCTTAGATGTGGCGTTTATGAAGGCAATACACAACAAGGTGAATATTGTGCCTGTCATTGCAAAAGCT GACACTCTCACCCTGAAGGAACGGGAGCGGCTGAAGAAAAGGATTCTGGATGAAATTGAAGAACATAAC ATCAAAATCTATCACTTACCTGATGCAGAATCAGATGAAGATGAAGATTTTAAAGAGCAGACTAGACTT CTCAAGGCTAGCATCCCATTCTCTGTGGTTGGATCCAATCAGTTGATTGAAGCCAAAGGAAAGAAGGTC AGAGGCCGCCTCTACCCCTGGGGTGTTGTGGAAGTGGAGAACCCAGAGCACAATGACTTTCTGAAGCTG AGAACCATGCTCATCACCCACATGCAGGATCTCCAGGAGGTGACCCAGGACCTTCATTATGAAAACTTC CGTTCTGAGAGACTCAAGAGAGGCGGCAGGAAAGTGGAGAATGAGGACATGAATAAAGACCAGATCTTG CTGGAAAAAGAAGCTGAGCTCCGCCGCATGCAAGAGATGATTGCAAGGATGCAGGCGCAGATGCAGATG CAGATGCAGGGCGGGGATGGCGATGGCGGGGCTCTCGGGCACCACGTGTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001008491 |
Insert Size | 1086 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001008491.2 |
RefSeq Size | 3726 bp |
RefSeq ORF | 1086 bp |
Locus ID | 4735 |
UniProt ID | Q15019 |
MW | 41.5 kDa |
Gene Summary | Filament-forming cytoskeletal GTPase. Forms a filamentous structure with SEPTIN12, SEPTIN6, SEPTIN2 and probably SEPTIN4 at the sperm annulus which is required for the structural integrity and motility of the sperm tail during postmeiotic differentiation (PubMed:25588830). Required for normal organization of the actin cytoskeleton. Plays a role in the biogenesis of polarized columnar-shaped epithelium by maintaining polyglutamylated microtubules, thus facilitating efficient vesicle transport, and by impeding MAP4 binding to tubulin. Required for the progression through mitosis. Forms a scaffold at the midplane of the mitotic splindle required to maintain CENPE localization at kinetochores and consequently chromosome congression. During anaphase, may be required for chromosome segregation and spindle elongation. Plays a role in ciliogenesis and collective cell movements. In cilia, required for the integrity of the diffusion barrier at the base of the primary cilium that prevents diffusion of transmembrane proteins between the cilia and plasma membranes: probably acts by regulating the assembly of the tectonic-like complex (also named B9 complex) by localizing TMEM231 protein. May play a role in the internalization of 2 intracellular microbial pathogens, Listeria monocytogenes and Shigella flexneri.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) represents the longest transcript and encodes isoform a. Variants 1-4, 8-13, and 16-18 encode the same isoform (a). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC224864 | SEPT2 (Myc-DDK-tagged)-Human septin 2 (SEPT2), transcript variant 1 |
CNY 3,656.00 |
|
RC224864L1 | Lenti-ORF clone of 41519 (Myc-DDK-tagged)-Human septin 2 (SEPT2), transcript variant 1 |
CNY 6,056.00 |
|
RC224864L2 | Lenti-ORF clone of 41519 (mGFP-tagged)-Human septin 2 (SEPT2), transcript variant 1 |
CNY 5,890.00 |
|
RC224864L3 | Lenti-ORF clone of 41519 (Myc-DDK-tagged)-Human septin 2 (SEPT2), transcript variant 1 |
CNY 6,056.00 |
|
RC224864L4 | Lenti-ORF clone of 41519 (mGFP-tagged)-Human septin 2 (SEPT2), transcript variant 1 |
CNY 5,890.00 |
|
RG224864 | SEPT2 (tGFP-tagged)-Human septin 2 (SEPT2), transcript variant 1 |
CNY 4,370.00 |
其它Septin 2产品