RBPMS (NM_001008711) Human Untagged Clone

CAT#: SC301351

RBPMS (untagged)-Human RNA binding protein with multiple splicing (RBPMS), transcript variant 2



  "NM_001008711" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
RBPMS mouse monoclonal antibody, clone OTI3B7 (formerly 3B7)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HERMES
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_001008711, the custom clone sequence may differ by one or more nucleotides
ATGAACAACGGCGGCAAAGCCGAGAAGGAGAACACCCCGAGCGAGGCCAACCTTCAGGAG
GAGGAGGTCCGGACCCTATTTGTCAGTGGCCTTCCTCTGGATATCAAACCTCGGGAGCTC
TATCTGCTTTTCAGACCATTTAAGGGCTATGAGGGTTCTCTTATAAAGCTCACATCTAAA
CAGCCTGTAGGTTTTGTCAGTTTTGACAGTCGCTCAGAAGCAGAGGCTGCAAAGAATGCT
TTGAATGGCATCCGCTTCGATCCTGAAATTCCGCAAACACTACGACTAGAGTTTGCTAAG
GCAAACACGAAGATGGCCAAGAACAAACTCGTAGGGACTCCAAACCCCAGTACTCCTCTG
CCCAACACTGTACCTCAGTTCATTGCCAGAGAGCCATATGAGCTCACAGTGCCTGCACTT
TACCCCAGTAGCCCTGAAGTGTGGGCCCCGTACCCTCTGTACCCAGCGGAGTTAGCGCCT
GCTCTACCTCCTCCTGCTTTCACCTATCCCGCTTCACTGCATGCCCAGCTCTGTGAAGGT
CAGACTGTGAGGAGAAGCCACCCCTTGAGCGCTCCGTCTCCTGATAGTGCCAGCCTGGCC
TGGTTTCCTGTTTGA
Restriction Sites Please inquire     
ACCN NM_001008711
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001008711.1, NP_001008711.1
RefSeq Size 3034 bp
RefSeq ORF 615 bp
Locus ID 11030
UniProt ID Q93062
Protein Families Stem cell - Pluripotency
Gene Summary This gene encodes a member of the RNA recognition motif family of RNA-binding proteins. The RNA recognition motif is between 80-100 amino acids in length and family members contain one to four copies of the motif. The RNA recognition motif consists of two short stretches of conserved sequence, as well as a few highly conserved hydrophobic residues. The encoded protein has a single, putative RNA recognition motif in its N-terminus. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jun 2013]
Transcript Variant: This variant (2) includes an alternate exon in the 3' coding region which results in a frameshift and an early stop codon, compared to variant 1. The encoded isoform (B) has a longer and distinct C-terminus, compared to isoform A.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...