TCP1 alpha (TCP1) (NM_001008897) Human Untagged Clone
CAT#: SC301386
TCP1 (untagged)-Human t-complex 1 (TCP1), transcript variant 2
CNY 7,220.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CCT-alpha; CCT1; CCTa; D6S230E; TCP-1-alpha |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001008897, the custom clone sequence may differ by one or more nucleotides
ATGTCTTCCAAAATCATTGGAATAAATGGTGATTTCTTTGCTAACATGGTAGTAGATGCT GTACTTGCTATTAAATACACAGACATAAGAGGCCAGCCACGCTATCCAGTCAACTCTGTT AATATTTTGAAAGCCCATGGGAGAAGTCAAATGGAGAGTATGCTCATCAGTGGCTATGCA CTCAACTGTGTGGTGGGATCCCAGGGCATGCCCAAGAGAATCGTAAATGCAAAAATTGCT TGCCTTGACTTCAGCCTGCAAAAAACAAAAATGAAGCTTGGTGTACAGGTGGTCATTACA GACCCTGAAAAACTGGACCAAATTAGACAGAGAGAATCAGATATCACCAAGGAGAGAATT CAGAAGATCCTGGCAACTGGTGCCAATGTTATTCTAACCACTGGTGGAATTGATGATATG TGTCTGAAGTATTTTGTGGAGGCTGGTGCTATGGCAGTTAGAAGAGTTTTAAAAAGGGAC CTTAAACGCATTGCCAAAGCTTCTGGAGCAACTATTCTGTCAACCCTGGCCAATTTGGAA GGTGAAGAAACTTTTGAAGCTGCAATGTTGGGACAGGCAGAAGAAGTGGTACAGGAGAGA ATTTGTGATGATGAGCTGATCTTAATCAAAAATACTAAGGCTCGTACGTCTGCATCGATT ATCTTACGTGGGGCAAATGATTTCATGTGTGATGAGATGGAGCGCTCTTTACATGATGCA CTTTGTGTAGTGAAGAGAGTTTTGGAGTCAAAATCTGTGGTTCCCGGTGGGGGTGCTGTA GAAGCAGCCCTTTCCATATACCTTGAAAACTATGCAACCAGCATGGGGTCTCGGGAACAG CTTGCGATTGCAGAGTTTGCAAGATCACTTCTTGTTATTCCCAATACACTAGCAGTTAAT GCTGCCCAGGACTCCACAGATCTGGTTGCAAAATTAAGAGCTTTTCATAATGAGGCCCAG GTTAACCCAGAACGTAAAAATCTAAAATGGATTGGTCTTGATTTGAGCAATGGTAAACCT CGAGACAACAAACAAGCAGGGGTGTTTGAACCAACCATAGTTAAAGTTAAGAGTTTGAAA TTTGCAACAGAAGCTGCAATCACCATTCTTCGAATTGATGATCTTATTAAATTACATCCA GAAAGTAAAGATGATAAACATGGAAGTTATGAAGATGCTGTTCACTCTGGAGCCCTTAAT GATTGA |
Restriction Sites | Please inquire |
ACCN | NM_001008897 |
OTI Disclaimer | Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery. The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001008897.1, NP_001008897.1 |
RefSeq Size | 2377 bp |
RefSeq ORF | 1206 bp |
Locus ID | 6950 |
Gene Summary | The protein encoded by this gene is a molecular chaperone that is a member of the chaperonin containing TCP1 complex (CCT), also known as the TCP1 ring complex (TRiC). This complex consists of two identical stacked rings, each containing eight different proteins. Unfolded polypeptides enter the central cavity of the complex and are folded in an ATP-dependent manner. The complex folds various proteins, including actin and tubulin. Alternate transcriptional splice variants of this gene, encoding different isoforms, have been characterized. In addition, three pseudogenes that appear to be derived from this gene have been found. [provided by RefSeq, Jun 2010] Transcript Variant: This variant (2) lacks an alternate in-frame exon in the 5' coding region and uses a downstream start codon, compared to variant 1. The resulting protein (isoform b) has a shorter N-terminus, compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC217372 | TCP1 (Myc-DDK-tagged)-Human t-complex 1 (TCP1), transcript variant 2 |
CNY 6,632.00 |
|
RC217372L3 | Lenti-ORF clone of TCP1 (Myc-DDK-tagged)-Human t-complex 1 (TCP1), transcript variant 2 |
CNY 5,890.00 |
|
RC217372L4 | Lenti-ORF clone of TCP1 (mGFP-tagged)-Human t-complex 1 (TCP1), transcript variant 2 |
CNY 5,890.00 |
|
RG217372 | TCP1 (tGFP-tagged) - Human t-complex 1 (TCP1), transcript variant 2 |
CNY 4,370.00 |