C20orf30 (TMEM230) (NM_001009924) Human Untagged Clone

CAT#: SC301443

TMEM230 (untagged)-Human chromosome 20 open reading frame 30 (C20orf30), transcript variant 2



  "NM_001009924" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
C20orf30 mouse monoclonal antibody, clone OTI2C8 (formerly 2C8)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C20orf30; dJ1116H23.2.1; HSPC274
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC301443 representing NM_001009924.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGATGCCGTCCCGTACCAACCTGGCTACTGGAATCCCCAGTAGTAAAGTGAAATATTCAAGGCTCTCC
AGCACAGACGATGGCTACATTGACCTTCAGTTTAAGAAAACCCCTCCTAAGATCCCTTATAAGGCCATC
GCACTTGCCACTGTGCTGTTTTTGATTGGCGCCTTTCTCATTATTATAGGCTCCCTCCTGCTGTCAGGC
TACATCAGCAAAGGGGGGGCAGACCGGGCCGTTCCAGTGCTGATCATTGGCATTCTGGTGTTCCTACCC
GGATTTTACCACCTGCGCATCGCTTACTATGCATCCAAAGGCTACCGTGGTTACTCCTATGATGACATT
CCAGACTTTGATGACTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001009924
Insert Size 363 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001009924.1
RefSeq Size 1792 bp
RefSeq ORF 363 bp
Locus ID 29058
UniProt ID Q96A57
Protein Families Transmembrane
MW 13.2 kDa
Gene Summary This gene encodes a multi-pass transmembrane protein that belongs to the TMEM134/TMEM230 protein family. The encoded protein localizes to secretory and recycling vesicle in the neuron and may be involved in synaptic vesicles trafficking and recycling. Mutations in this gene may be linked to familial Parkinson's disease. [provided by RefSeq, Mar 2017]
Transcript Variant: This variant (2) has an additional segment in the 5' region and uses a downstream AUG codon for translation initiation, as compared to variant 1. The encoded isoform (2) has a shorter N-terminus, as compared to isoform 1.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...