MAGEA4 (NM_001011549) Human Untagged Clone

CAT#: SC301577

MAGEA4 (untagged)-Human melanoma antigen family A, 4 (MAGEA4), transcript variant 3



  "NM_001011549" in other vectors (5)

CNY 2,400.00

CNY 6,270.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
MAGEA4 mouse monoclonal antibody, clone OTI1F9 (formerly 1F9)
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms CT1.4; MAGE-41; MAGE-X2; MAGE4; MAGE4A; MAGE4B
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene ORF sequence for NM_001011549 edited
ATGTCTTCTGAGCAGAAGAGTCAGCACTGCAAGCCTGAGGAAGGCGTTGAGGCCCAAGAA
GAGGCCCTGGGCCTGGTGGGTGCACAGGCTCCTACTACTGAGGAGCAGGAGGCTGCTGTC
TCCTCCTCCTCTCCTCTGGTCCCTGGCACCCTGGAGGAAGTGCCTGCTGCTGAGTCAGCA
GGTCCTCCCCAGAGTCCTCAGGGAGCCTCTGCCTTACCCACTACCATCAGCTTCACTTGC
TGGAGGCAACCCAATGAGGGTTCCAGCAGCCAAGAAGAGGAGGGGCCAAGCACCTCGCCT
GACGCAGAGTCCTTGTTCCGAGAAGCACTCAGTAACAAGGTGGATGAGTTGGCTCATTTT
CTGCTCCGCAAGTATCGAGCCAAGGAGCTGGTCACAAAGGCAGAAATGCTGGAGAGAGTC
ATCAAAAATTACAAGCGCTGCTTTCCTGTGATCTTCGGCAAAGCCTCCGAGTCCCTGAAG
ATGATCTTTGGCATTGACGTGAAGGAAGTGGACCCCACCAGCAACACCTACACCCTTGTC
ACCTGCCTGGGCCTTTCCTATGATGGCCTGCTGGGTAATAATCAGATCTTTCCCAAGACA
GGCCTTCTGATAATCGTCCTGGGCACAATTGCAATGGAGGGCGACAGCGCCTCTGAGGAG
GAAATCTGGGAGGAGCTGGGTGTGATGGGGGTGTATGATGGGAGGGAGCACACTGTCTAT
GGGGAGCCCAGGAAACTGCTCACCCAAGATTGGGTGCAGGAAAACTACCTGGAGTACCGG
CAGGTACCCGGCAGTAATCCTGCGCGCTATGAGTTCCTGTGGGGTCCAAGGGCTCTGGCT
GAAACCAGCTATGTGAAAGTCCTGGAGCATGTGGTCAGGGTCAATGCAAGAGTTCGCATT
GCCTACCCATCCCTGCGTGAAGCAGCTTTGTTAGAGGAGGAAGAGGGAGTCTGA
Restriction Sites NotI-NotI     
ACCN NM_001011549
Insert Size 1700 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to contain one SNP compared with NM_001011549.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_001011549.1, NP_001011549.1
RefSeq Size 1721 bp
RefSeq ORF 954 bp
Locus ID 4103
UniProt ID P43358
Gene Summary This gene is a member of the MAGEA gene family. The members of this family encode proteins with 50 to 80% sequence identity to each other. The promoters and first exons of the MAGEA genes show considerable variability, suggesting that the existence of this gene family enables the same function to be expressed under different transcriptional controls. The MAGEA genes are clustered at chromosomal location Xq28. They have been implicated in some hereditary disorders, such as dyskeratosis congenita. Several variants encoding the same protein have been found for this gene. [provided by RefSeq, Aug 2020]
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. All four variants encode the same protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...