United States
Germany
Japan
United Kingdom
China
BIRC5 (NM_001012270) Human Untagged Clone
CAT＃: SC301617
BIRC5 (untagged)-Human baculoviral IAP repeat containing 5 (BIRC5/Survivin), transcript variant 2
CNY 1,200.00
CNY 3,990.00
| Cited in 2 publications. |
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | API4; EPR-1 |
| Vector | pCMV6-XL4 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene ORF sequence for NM_001012270 edited
ATGGGTGCCCCGACGTTGCCCCCTGCCTGGCAGCCCTTTCTCAAGGACCACCGCATCTCT ACATTCAAGAACTGGCCCTTCTTGGAGGGCTGCGCCTGCACCCCGGAGCGGATGGCCGAG GCTGGCTTCATCCACTGCCCCACTGAGAACGAGCCAGACTTGGCCCAGTGTTTCTTCTGC TTCAAGGAGCTGGAAGGCTGGGAGCCAGATGACGACCCCATGCAAAGGAAACCAACAATA AGAAGAAAGAATTTGAGGAAACTGCGGAGAAAGTGCGCCGTGCCATCGAGCAGCTGGCTG CCATGGATTGAGGCCTCTGGCCGGAGCTGCCTGGTCCCAGAGTGGCTGCACCACTTCCAG GGTTTATTCCCTGGTGCCACCAGCCTTCCTGTGGGCCCCTTAGCAATGTCTTAG |
| Restriction Sites | Please inquire |
| ACCN | NM_001012270 |
| Insert Size | 2800 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001012270.1. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001012270.1, NP_001012270.1 |
| RefSeq Size | 2537 bp |
| RefSeq ORF | 414 bp |
| Locus ID | 332 |
| UniProt ID | O15392 |
| Protein Families | Druggable Genome, Stem cell - Pluripotency |
| Protein Pathways | Colorectal cancer, Pathways in cancer |
| Gene Summary | This gene is a member of the inhibitor of apoptosis (IAP) gene family, which encode negative regulatory proteins that prevent apoptotic cell death. IAP family members usually contain multiple baculovirus IAP repeat (BIR) domains, but this gene encodes proteins with only a single BIR domain. The encoded proteins also lack a C-terminus RING finger domain. Gene expression is high during fetal development and in most tumors, yet low in adult tissues. Alternatively spliced transcript variants encoding distinct isoforms have been found for this gene. [provided by RefSeq, Jun 2011] Transcript Variant: This variant (2), also known as survivin-deltaEx3, lacks an exon in the 3' coding region which results in a frameshift, compared to variant 1. The encoded isoform (2) is shorter and has a distinct C-terminus when it is compared to isoform 1. |
Citations (2)
| The use of this cDNA Clones has been cited in the following citations: |
|---|
|
Survivin transcript variant 2 drives angiogenesis and malignant progression in proneural gliomas
,Doucette, T;Latha, K;Yang, Y;Fuller, GN;Rao, A;Rao, G;,
Neuro-oncology
,PubMed ID 24676140
[BIRC5]
|
|
Blockade of Rac1 Activity Induces G1 Cell Cycle Arrest or Apoptosis in Breast Cancer Cells through Downregulation of Cyclin D1, Survivin, and X-Linked Inhibitor of Apoptosis Protein
,Tatsushi Yoshida, Yaqin Zhang, Leslie A. Rivera Rosado, Junjie Chen, Tahira Khan, Sun Young Moon, and Baolin Zhang,
Mol. Cancer Ther., Jun 2010; 9: 1657 - 1668
[BIRC5]
|
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC212205 | BIRC5 (Myc-DDK-tagged)-Human baculoviral IAP repeat containing 5 (BIRC5/Survivin), transcript variant 2 |
CNY 1,200.00 |
|
| RC212205L3 | Lenti ORF clone of Human baculoviral IAP repeat containing 5 (BIRC5), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC212205L4 | Lenti ORF clone of Human baculoviral IAP repeat containing 5 (BIRC5), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG212205 | BIRC5 (tGFP-tagged) - Human baculoviral IAP repeat containing 5 (BIRC5/Survivin), transcript variant 2 |
CNY 4,370.00 |
