United States
Germany
Japan
United Kingdom
China
Gastrin Releasing Peptide (GRP) (NM_001012513) Human Untagged Clone
CAT＃: SC301675
GRP (untagged)-Human gastrin-releasing peptide (GRP), transcript variant 3
CNY 1,200.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | BN; GRP-10; preproGRP; proGRP |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_001012513 edited
CCAGCGGCTGCGGCGGCGGAGCTCCTCCGAGGTCCGGGTCACCAGTCTCTGCTCTTCCCA GCCTCTCCGGCGCGCTCCAAGGGCTTCCCGTCGGGACCATGCGCGGCCGTGAGCTCCCGC TGGTCCTGCTGGCGCTGGTCCTCTGCCTGGCGCCCCGGGGGCGAGCGGTCCCGCTGCCTG CGGGCGGAGGGACCGTGCTGACCAAGATGTACCCGCGCGGCAACCACTGGGCGGTGGGGC ACTTAATGGGGAAAAAGAGCACAGGGGAGTCTTCTTCTGTTTCTGAGAGAGGGAGCCTGA AGCAGCAGCTGAGAGAGTACATCAGGTGGGAAGAAGCTGCAAGGAATTTGCTGGGTCTCA TAGAAGCAAAGGAGAACAGAAACCACCAGCCACCTCAACCCAAGGCCCTGGGCAATCAGC AGCCTTCGTGGGATTCAGAGGATAGCAGCAACTTCAAAGATTTGGTAGACTCTCTGCTCC AGGTTCTCAACGTGAAGGAAGGAACCCCCAGCTGAACCAGCAATGATAATGATGGCCTCT CTCAAAAGAGAAAAACAAAACCCCTAAGAGACTGCGTTCTGCAAGCATCAGTTCTACGGA TCATCAACAAGATTTCCTTGTGCAAAATATTTGACTATTCTGTATCTTTCATCCTTGACT AAATTCGTGATTTTCAAGCAGCATCTTCTGGTTTAAACTTGTTTGCTGTGAACAATTGTC GAAAAGAGTCTTCCAATTAATGCTTTTTTATATCTAGGCTACCTGTTGGTTAGATTCAAG GCCCCGAGCTGTTACCATTCACAATAAAAGCTTAAACACATTGTCCAAAAAAAAAAAAAA AAAA |
| Restriction Sites | Please inquire |
| ACCN | NM_001012513 |
| Insert Size | 800 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001012513.1. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Reference Data | |
| RefSeq | NM_001012513.1, NP_001012531.1 |
| RefSeq Size | 844 bp |
| RefSeq ORF | 417 bp |
| Locus ID | 2922 |
| UniProt ID | P07492 |
| Protein Families | Secreted Protein |
| Gene Summary | This gene encodes a member of the bombesin-like family of gastrin-releasing peptides. The encoded preproprotein is proteolytically processed to generate two peptides, gastrin-releasing peptide and neuromedin-C. These peptides regulate numerous functions of the gastrointestinal and central nervous systems, including release of gastrointestinal hormones, smooth muscle cell contraction, and epithelial cell proliferation. These peptides are also likely to play a role in human cancers of the lung, colon, stomach, pancreas, breast, and prostate. Alternative splicing results in multiple transcript variants, at least one of which encodes a preproprotein that is proteolytically processed. [provided by RefSeq, Jan 2016] Transcript Variant: This variant (3) uses an alternate splice site in the coding region, which results in a frameshift and an early stop codon, compared to variant 1. It encodes isoform 3 which has a shorter and distinct C-terminus, compared to isoform 1. This variant has also been identified as 'splice isoform 2', 'pro-gastrin releasing peptide type 3', and 'gastrin-releasing peptide nirs variant 1'. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC215122 | GRP (Myc-DDK-tagged)-Human gastrin-releasing peptide (GRP), transcript variant 3 |
CNY 1,200.00 |
|
| RC215122L3 | Lenti ORF clone of Human gastrin-releasing peptide (GRP), transcript variant 3, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC215122L4 | Lenti ORF clone of Human gastrin-releasing peptide (GRP), transcript variant 3, mGFP tagged |
CNY 5,890.00 |
|
| RG215122 | GRP (tGFP-tagged) - Human gastrin-releasing peptide (GRP), transcript variant 3 |
CNY 4,370.00 |
其它Gastrin Releasing Peptide产品
