CUTA (NM_001014433) Human Untagged Clone
CAT#: SC301931
CUTA (untagged)-Human cutA divalent cation tolerance homolog (E. coli) (CUTA), transcript variant 1
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | ACHAP; C6orf82 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001014433, the custom clone sequence may differ by one or more nucleotides
ATGATAGGGTCGGGATTGGCTGGCTCTGGAGGCGCAGGTGGTCCTTCTTCTACTGTCACA TGGTGCGCGCTGTTTTCTAATCACGTGGCTGCCACCCAGGCCTCTCTGCTCCTGTCTTTT GTTTGGATGCCGGCGCTGCTGCCTGTGGCCTCCCGCCTTTTGTTGCTACCCCGAGTCTTG CTGACCATGGCCTCTGGAAGCCCTCCGACCCAGCCCTCGCCGGCCTCGGATTCCGGCTCT GGCTACGTTCCGGGCTCGGTCTCTGCAGCCTTTGTTACTTGCCCCAACGAGAAGGTCGCC AAGGAGATCGCCAGGGCCGTGGTGGAGAAGCGCCTAGCAGCCTGCGTCAACCTCATCCCT CAGATTACATCCATCTATGAGTGGAAAGGGAAGATCGAGGAAGACAGTGAGGTGCTGATG ATGATTAAAACCCAAAGTTCCTTGGTCCCAGCTTTGACAGATTTTGTTCGTTCTGTGCAC CCTTACGAAGTGGCCGAGGTAATTGCATTGCCTGTGGAACAGGGGAACTTTCCGTACCTG CAGTGGGTGCGCCAGGTCACAGAGTCAGTTTCTGACTCTATCACAGTCCTGCCATGA |
Restriction Sites | Please inquire |
ACCN | NM_001014433 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001014433.2, NP_001014433.1 |
RefSeq Size | 823 bp |
RefSeq ORF | 597 bp |
Locus ID | 51596 |
UniProt ID | O60888 |
Protein Families | Transmembrane |
Gene Summary | May form part of a complex of membrane proteins attached to acetylcholinesterase (AChE).[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes the longest isoform (1). This isoform has also been named isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC224308 | CUTA (Myc-DDK-tagged)-Human cutA divalent cation tolerance homolog (E. coli) (CUTA), transcript variant 1 |
CNY 3,990.00 |
|
RC224308L3 | Lenti-ORF clone of CUTA (Myc-DDK-tagged)-Human cutA divalent cation tolerance homolog (E. coli) (CUTA), transcript variant 1 |
CNY 5,890.00 |
|
RC224308L4 | Lenti-ORF clone of CUTA (mGFP-tagged)-Human cutA divalent cation tolerance homolog (E. coli) (CUTA), transcript variant 1 |
CNY 5,890.00 |
|
RG224308 | CUTA (tGFP-tagged) - Human cutA divalent cation tolerance homolog (E. coli) (CUTA), transcript variant 1 |
CNY 4,370.00 |