GCOM1 (NM_001018091) Human Untagged Clone

CAT#: SC302173

GCOM1 (untagged)-Human GRINL1A complex locus (GCOM1), transcript variant 2



  "NM_001018091" in other vectors (6)

CNY 7,130.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit Polyclonal Anti-Gcom1 Antibody
    • 100 ul

CNY 5,250.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms gcom; Gcom2; GRINL1A; MYZAP; MYZAP-POLR2M
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC302173 representing NM_001018091.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGCTGCGCTCCACGTCCACGGTCACCCTGCTCTCGGGCGGCGCCGCCAGGACGCCCGGGGCGCCCAGC
AGGAGGGCAAATGTTTGCAGACTACGGCTGACCGTACCTCCTGAGAGTCCAGTTCCTGAGCAATGTGAA
AAGAAGATTGAGAGAAAAGAGCAGCTTCTTGACCTGAGCAATGGAGAACCTACCAGGAAACTTCCTCAG
GGTGTTGTTTATGGTGTGGTGCGAAGATCAGATCAAAATCAGCAGAAAGAAATGGTGGTGTATGGGTGG
TCCACCAGTCAGCTGAAAGAAGAGATGAACTACATCAAAGATGTGAGAGCCACTTTGGAAAAGGTGAGA
AAGCGAATGTATGGAGACTATGATGAGATGAGACAGAAGATTCGACAGCTCACCCAGGAACTATCAGTT
TCCCATGCTCAGCAGGAGTATCTGGAGAATCACATCCAAACCCAGTCGTCTGCCCTGGATCGTTTTAAT
GCCATGAACTCAGCCTTGGCATCAGATTCCATTGGCCTGCAGAAAACCCTCGTGGATGTGACTTTGGAA
AACAGCAACATTAAGGATCAAATCAGAAATCTGCAGCAGACGTATGAAGCATCCATGGACAAGCTGAGG
GAAAAGCAGAGGCAGTTGGAGGTAGCGCAAGTTGAAAACCAGCTGCTAAAAATGAAGGTGGAATCGTCC
CAAGAAGCCAATGCTGAGGTGATGCGAGAGATGACCAAGAAGCTGTACAGCCAGTATGAGGAGAAGCTG
CAGGAAGAACAGAGGAAGCACAGTGCTGAGAAGGAGGCTCTTTTGGAAGAAACCAATAGTTTTCTGAAA
GCGATTGAAGAAGCCAATAAAAAGATGCAAGCAGCAGAGATCAGCCTAGAGGAGAAAGACCAGAGGATC
GGGGAGCTGGACAGGCTGATTGAGCGCATGGAAAAGGAACGTCATCAACTGCAACTTCAACTCCTAGAA
CATGAAACAGAAATGTCTGGGGAGTTAACTGATTCTGACAAGGAAAGGTATCAGCAGTTGGAGGAGGCA
TCAGCCAGCCTCCGTGAGCGGATCAGACACCTAGATGACATGGTGCATTGCCAGCAGAAGAAAGTCAAG
CAGATGGTCGAGGAGATTGAATCATTAAAGAAAAAGTTGCAACAGAAACAGCTCTTAATACTGCAGCTT
TTAGAAAAGATATCTTTCTTAGAAGGAGAGAATAATGAACTACAAAGCAGGTTGGACTATTTAACAGAA
ACCCAGGCCAAGACCGAAGTGGAAACCAGAGAGATAGGAGTGGGCTGTGATCTTCTACCCAGGAGATGC
AAGCAAAGCTCGCAGCGCAAAAATTAG

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_001018091
Insert Size 1338 bp
OTI Disclaimer Due to the inherent nature of this plasmid, standard methods to replicate additional amounts of DNA in E. coli are highly likely to result in mutations and/or rearrangements. Therefore, OriGene does not guarantee the capability to replicate this plasmid DNA. Additional amounts of DNA can be purchased from OriGene with batch-specific, full-sequence verification at a reduced cost. Please contact our customer care team at custsupport@origene.com or by calling 301.340.3188 option 3 for pricing and delivery.

The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_001018091.6
RefSeq Size 4457 bp
RefSeq ORF 1338 bp
Locus ID 145781
UniProt ID P0CAP1
Protein Families Druggable Genome
MW 51.8 kDa
Gene Summary This locus represents naturally occurring readthrough transcription between the neighboring MYZAP (myocardial zonula adherens protein) and POLR2M (polymerase (RNA) II (DNA directed) polypeptide M) genes on chromosome 15. Alternative splicing results in multiple readthrough transcript variants. Readthrough variants may encode proteins that share sequence identity with the upstream gene product or with both the upstream and downstream gene products. Some readthrough transcript variants are also expected to be candidates for nonsense-mediated decay (NMD). [provided by RefSeq, Oct 2013]
Transcript Variant: This variant (2, also known as Gcom2) lacks an alternate exon in the 3' coding region, which results in a frameshift, compared to variant 1. The resulting isoform (2) is shorter and has a distinct C-terminus, compared to isoform 1. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...