DUT (NM_001025248) Human Untagged Clone
CAT#: SC302382
DUT (untagged)-Human deoxyuridine triphosphatase (DUT), nuclear gene encoding mitochondrial protein, transcript variant 1
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | dUTPase |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001025248, the custom clone sequence may differ by one or more nucleotides
ATGACTCCCCTCTGCCCTCGCCCCGCGCTCTGCTACCATTTCCTTACGTCTCTGCTTCGC TCAGCGATGCAAAACGCGCGAGGCGCACGGCAGAGGGCCGAAGCCGCGGTACTCTCCGGG CCAGGCCCGCCCCTCGGCCGCGCCGCGCAGCACGGGATTCCCCGGCCGCTGTCCAGCGCT GGCCGCCTGAGCCAAGGCTGCCGCGGAGCCAGTACAGTCGGGGCCGCTGGCTGGAAGGGC GAGCTTCCTAAGGCGGGGGGAAGCCCGGCGCCGGGGCCGGAGACACCCGCCATTTCACCC AGTAAGCGGGCCCGGCCTGCGGAGGTGGGCGGCATGCAGCTCCGCTTTGCCCGGCTCTCC GAGCACGCCACGGCCCCCACCCGGGGCTCCGCGCGCGCCGCGGGCTACGACCTGTACAGT GCCTATGATTACACAATACCACCTATGGAGAAAGCTGTTGTGAAAACGGACATTCAGATA GCGCTCCCTTCTGGGTGTTATGGAAGAGTGGCTCCACGGTCAGGCTTGGCTGCAAAACAC TTTATTGATGTAGGAGCTGGTGTCATAGATGAAGATTATAGAGGAAATGTTGGTGTTGTA CTGTTTAATTTTGGCAAAGAAAAGTTTGAAGTCAAAAAAGGTGATCGAATTGCACAGCTC ATTTGCGAACGGATTTTTTATCCAGAAATAGAAGAAGTTCAAGCCTTGGATGACACCGAA AGGGGTTCAGGAGGTTTTGGTTCCACTGGAAAGAATTAA |
Restriction Sites | Please inquire |
ACCN | NM_001025248 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001025248.1, NP_001020419.1 |
RefSeq Size | 2146 bp |
RefSeq ORF | 759 bp |
Locus ID | 1854 |
UniProt ID | P33316 |
Protein Families | Druggable Genome |
Protein Pathways | Metabolic pathways, Pyrimidine metabolism |
Gene Summary | This gene encodes an essential enzyme of nucleotide metabolism. The encoded protein forms a ubiquitous, homotetrameric enzyme that hydrolyzes dUTP to dUMP and pyrophosphate. This reaction serves two cellular purposes: providing a precursor (dUMP) for the synthesis of thymine nucleotides needed for DNA replication, and limiting intracellular pools of dUTP. Elevated levels of dUTP lead to increased incorporation of uracil into DNA, which induces extensive excision repair mediated by uracil glycosylase. This repair process, resulting in the removal and reincorporation of dUTP, is self-defeating and leads to DNA fragmentation and cell death. Alternative splicing of this gene leads to different isoforms that localize to either the mitochondrion or nucleus. A related pseudogene is located on chromosome 19. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1), also known as DUT-M, represents the longest transcript. It encodes the longest isoform (1), which includes a mitochondrial targeting sequence. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC210014 | DUT (Myc-DDK-tagged)-Human deoxyuridine triphosphatase (DUT), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 3,990.00 |
|
RC210014L3 | Lenti-ORF clone of DUT (Myc-DDK-tagged)-Human deoxyuridine triphosphatase (DUT), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 5,890.00 |
|
RC210014L4 | Lenti-ORF clone of DUT (mGFP-tagged)-Human deoxyuridine triphosphatase (DUT), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 5,890.00 |
|
RG210014 | DUT (tGFP-tagged) - Human deoxyuridine triphosphatase (DUT), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 4,370.00 |
|
SC321001 | DUT (untagged)-Human deoxyuridine triphosphatase (DUT), nuclear gene encoding mitochondrial protein, transcript variant 1 |
CNY 2,400.00 |