United States
Germany
Japan
United Kingdom
China
SPAG16 (NM_001025436) Human Untagged Clone
CAT＃: SC302404
SPAG16 (untagged)-Human sperm associated antigen 16 (SPAG16), transcript variant 2
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | PF20; WDR29 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC302404 representing NM_001025436.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCTGCTCAGCGAGGGATGCCCAGCTCCGCCGTGAGGGTCCTGGAAGAGGCGTTGGGCATGGGTTTG ACGGCAGCCGGGGACGCGAGGGACACGGCGGACGCGGTGGCGGCTGAGGGCGCCTACTACCTGGAACAG GTCACCATAACTGAAGCATCTGAAGATGACTATGAATATGAAGAGATACCAGATGACAATTTTAGCATC CCAGAAGGTGAAGAAGATCTGGCAAAAGCAATTCAGATGGCCCAAGAACAGGCTACAGATACTGAAATT TTGGAACGGAAAACAGTTCTTCCTTCAAAGCATGCAGTACCTGAAGTAATAGAAGACTTTCTCTGCAAT TTCTTGATCAAAATGGGAATGACCAGAACTCTTGATTGCTTTCAGTCTGAATGGTATGAGTTAATACAG AAAGGAGTGACTGAACTTAGAACTGTTGGGAATGTTCCAGATGTCTACACCCAGATTATGCTTTTGGAA AATGAGAACAAAAATTTAAAGAAAGATTTGAAGCACTACAAACAAGCAGCTGAGTATGTTATTTTTTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_001025436 |
| Insert Size | 552 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_001025436.2 |
| RefSeq Size | 1287 bp |
| RefSeq ORF | 552 bp |
| Locus ID | 79582 |
| UniProt ID | Q8N0X2 |
| MW | 20.6 kDa |
| Gene Summary | Cilia and flagella are comprised of a microtubular backbone, the axoneme, which is organized by the basal body and surrounded by plasma membrane. SPAG16 encodes 2 major proteins that associate with the axoneme of sperm tail and the nucleus of postmeiotic germ cells, respectively (Zhang et al., 2007 [PubMed 17699735]).[supplied by OMIM, Jul 2008] Transcript Variant: This variant (2) differs in the 3' UTR and lacks a large portion of the 3' coding region, compared to variant 1. The encoded isoform (2) is significantly shorter and has a distinct C-terminus, compared to isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC215059 | SPAG16 (Myc-DDK-tagged)-Human sperm associated antigen 16 (SPAG16), transcript variant 2 |
CNY 2,400.00 |
|
| RC215059L3 | Lenti ORF clone of Human sperm associated antigen 16 (SPAG16), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC215059L4 | Lenti ORF clone of Human sperm associated antigen 16 (SPAG16), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG215059 | SPAG16 (tGFP-tagged) - Human sperm associated antigen 16 (SPAG16), transcript variant 2 |
CNY 4,370.00 |
