NANOS2 (NM_001029861) Human Untagged Clone
CAT#: SC302446
NANOS2 (untagged)-Human nanos homolog 2 (Drosophila) (NANOS2)
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | NOS2; ZC2HC12B |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC302446 representing NM_001029861.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGCAGCTGCCACCCTTCGACATGTGGAAGGACTACTTCAACCTGAGCCAGGTGGTGTGGGCGCTGATC GCAAGTCGGGGTCAAAGGCTGGAGACCCAAGAGATTGAGGAGCCAAGTCCCGGGCCTCCGCTGGGGCAG GATCAGGGGCTGGGGGCGCCAGGGGCCAACGGGGGCCTGGGGACCCTGTGCAACTTCTGCAAGCACAAC GGGGAGTCCCGCCACGTCTACTCCTCACACCAGCTGAAGACACCGGATGGCGTGGTGGTGTGTCCCATC CTGAGGCACTACGTGTGTCCCGTGTGCGGGGCCACCGGTGACCAGGCCCATACGCTCAAGTACTGCCCG CTTAACGGTGGCCAGCAGTCCCTCTACCGCCGCAGCGGGCGCAACTCGGCCGGACGCAGGGTCAAGCGC TGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001029861 |
Insert Size | 417 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001029861.2 |
RefSeq Size | 1577 bp |
RefSeq ORF | 417 bp |
Locus ID | 339345 |
UniProt ID | P60321 |
MW | 15.1 kDa |
Gene Summary | Plays a key role in the sexual differentiation of germ cells by promoting the male fate but suppressing the female fate. Represses the female fate pathways by suppressing meiosis, which in turn results in the promotion of the male fate. Maintains the suppression of meiosis by preventing STRA8 expression, which is required for premeiotic DNA replication, after CYP26B1 is decreased. Regulates the localization of the CCR4-NOT deadenylation complex to P-bodies and plays a role in recruiting the complex to trigger the degradation of mRNAs involved in meiosis. Required for the maintenance of the spermatogonial stem cell population. Not essential for the assembly of P-bodies but is required for the maintenance of their normal state (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212815 | NANOS2 (Myc-DDK-tagged)-Human nanos homolog 2 (Drosophila) (NANOS2) |
CNY 1,200.00 |
|
RC212815L1 | Lenti ORF clone of Human nanos homolog 2 (Drosophila) (NANOS2), Myc-DDK-tagged |
CNY 3,600.00 |
|
RC212815L2 | Lenti ORF clone of Human nanos homolog 2 (Drosophila) (NANOS2), mGFP tagged |
CNY 5,890.00 |
|
RC212815L3 | Lenti ORF clone of Human nanos homolog 2 (Drosophila) (NANOS2), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC212815L4 | Lenti ORF clone of Human nanos homolog 2 (Drosophila) (NANOS2), mGFP tagged |
CNY 5,890.00 |
|
RG212815 | NANOS2 (tGFP-tagged) - Human nanos homolog 2 (Drosophila) (NANOS2) |
CNY 4,370.00 |