C1ORF151 (MINOS1) (NM_001032363) Human Untagged Clone
CAT#: SC302636
MINOS1 (untagged)-Human chromosome 1 open reading frame 151 (C1orf151), transcript variant 1
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | C1orf151; Mic10; MINOS1; MIO10 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC302636 representing NM_001032363.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGTCTGAGTCGGAGCTCGGCAGGAAGTGGGACCGGTGTCTGGCGGATGCGGTCGTGAAGATAGGTACT GGTTTTGGATTAGGAATTGTTTTCTCACTTACCTTCTTTAAAAGAAGAATGTGGCCATTAGCCTTCGGT TCTGGCATGGGATTAGGAATGGCTTATTCCAACTGTCAGCATGATTTCCAGGCTCCATATCTTCTACAT GGAAAATATGTCAAAGAGCAGGAGCAGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001032363 |
Insert Size | 237 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001032363.3 |
RefSeq Size | 3726 bp |
RefSeq ORF | 237 bp |
Locus ID | 440574 |
UniProt ID | Q5TGZ0 |
Protein Families | Transmembrane |
MW | 8.8 kDa |
Gene Summary | Component of the MICOS complex, a large protein complex of the mitochondrial inner membrane that plays crucial roles in the maintenance of crista junctions, inner membrane architecture, and formation of contact sites to the outer membrane.[UniProtKB/Swiss-Prot Function] Transcript Variant: This variant (1) encodes isoform a. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC212930 | MINOS1 (Myc-DDK-tagged)-Human chromosome 1 open reading frame 151 (C1orf151), transcript variant 1 |
CNY 1,200.00 |
|
RC212930L3 | Lenti ORF clone of Human chromosome 1 open reading frame 151 (C1orf151), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC212930L4 | Lenti ORF clone of Human chromosome 1 open reading frame 151 (C1orf151), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG212930 | MINOS1 (tGFP-tagged) - Human chromosome 1 open reading frame 151 (C1orf151), transcript variant 1 |
CNY 2,800.00 |
其它C1ORF151产品