CSTF3 (NM_001033505) Human Untagged Clone
CAT#: SC302707
CSTF3 (untagged)-Human cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa (CSTF3), transcript variant 2
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CSTF-77 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_001033505, the custom clone sequence may differ by one or more nucleotides
ATGTCAGGAGACGGAGCCACGGAGCAGGCAGCTGAGTATGTCCCAGAGAAGGTGAAGAAA GCGGAAAAGAAATTAGAAGAGAATCCATATGACCTTGATGCTTGGAGCATTCTCATTCGA GAGGCACAGAATCAACCTATAGACAAAGCACGGAAGACTTATGAACGCCTTGTTGCCCAG TTCCCCAGTTCTGGCAGATTCTGGAAACTGTACATTGAAGCAGAGGTTACTATTTTATTT TATTTTTTCTTATATCAGTATTGCAGCATTCACTGTAGTGATAGAAAACAAGTTAGGAAC ATAGCCAATTAG |
Restriction Sites | Please inquire |
ACCN | NM_001033505 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_001033505.1, NP_001028677.1 |
RefSeq Size | 655 bp |
RefSeq ORF | 312 bp |
Locus ID | 1479 |
UniProt ID | Q12996 |
Gene Summary | The protein encoded by this gene is one of three (including CSTF1 and CSTF2) cleavage stimulation factors that combine to form the cleavage stimulation factor complex (CSTF). This complex is involved in the polyadenylation and 3' end cleavage of pre-mRNAs. The encoded protein functions as a homodimer and interacts directly with both CSTF1 and CSTF2 in the CSTF complex. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) uses an alternate splice site in the 5' coding region, compared to variant 1. The encoded protein (isoform 2) is shorter and has a unique C-terminus, compared to isoform 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC219192 | CSTF3 (Myc-DDK-tagged)-Human cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa (CSTF3), transcript variant 2 |
CNY 3,990.00 |
|
RC219192L3 | Lenti-ORF clone of CSTF3 (Myc-DDK-tagged)-Human cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa (CSTF3), transcript variant 2 |
CNY 5,890.00 |
|
RC219192L4 | Lenti-ORF clone of CSTF3 (mGFP-tagged)-Human cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa (CSTF3), transcript variant 2 |
CNY 5,890.00 |
|
RG219192 | CSTF3 (tGFP-tagged) - Human cleavage stimulation factor, 3' pre-RNA, subunit 3, 77kDa (CSTF3), transcript variant 2 |
CNY 4,370.00 |