DEFB128 (NM_001037732) Human Untagged Clone
CAT#: SC302931
DEFB128 (untagged)-Human defensin, beta 128 (DEFB128)
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | DEFB-28; DEFB28; hBD-28 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC302931 representing NM_001037732.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAAGCTGTTTCTGGTTCTCATTATTCTGCTGTTTGAGGTACTCACAGACGGGGCAAGACTCAAAAAA TGCTTCAATAAAGTAACAGGCTATTGCAGGAAGAAATGCAAGGTAGGAGAAAGATATGAAATAGGATGT CTAAGTGGGAAATTATGTTGTGCTAATGATGAAGAAGAGAAAAAACATGTGTCATTTAAGAAGCCACAT CAACATTCTGGTGAGAAGCTGAGTGTGCTGCAGGATTACATCATCTTACCCACCATCACCATTTTCACA GTCTAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_001037732 |
Insert Size | 282 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001037732.2 |
RefSeq Size | 373 bp |
RefSeq ORF | 282 bp |
Locus ID | 245939 |
UniProt ID | Q7Z7B8 |
Protein Families | Secreted Protein |
MW | 10.6 kDa |
Gene Summary | Defensins are cysteine-rich cationic polypeptides that are important in the immunologic response to invading microorganisms. The antimicrobial protein encoded by this gene is secreted and is a member of the beta defensin protein family. Beta defensin genes are found in several clusters throughout the genome, with this gene mapping to a cluster at 20p13. [provided by RefSeq, Nov 2014] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC213397 | DEFB128 (Myc-DDK-tagged)-Human defensin, beta 128 (DEFB128) |
CNY 1,200.00 |
|
RC213397L3 | Lenti ORF clone of Human defensin, beta 128 (DEFB128), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC213397L4 | Lenti ORF clone of Human defensin, beta 128 (DEFB128), mGFP tagged |
CNY 5,890.00 |
|
RG213397 | DEFB128 (tGFP-tagged) - Human defensin, beta 128 (DEFB128) |
CNY 4,370.00 |
其它DEFB128产品