Aquaporin 8 (AQP8) (NM_001169) Human Untagged Clone
CAT#: SC302982
AQP8 (untagged)-Human aquaporin 8 (AQP8)
CNY 2,400.00
CNY 3,990.00
Cited in 2 publications. |
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AQP-8 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_001169 edited
ATGTCTGGAGAGATAGCCATGTGTGAGCCTGAATTTGGCAATGACAAGGCCAGGGAGCCG AGCGTGGGTGGCAGGTGGCGAGTGTCCTGGTACGAACGGTTTGTGCAGCCATGTCTGGTC GAACTGCTGGGCTCTGCTCTCTTCATCTTCATCGGGTGCCTGTCGGTCATTGAGAATGGG ACGGACACTGGGCTGCTGCAGCCGGCCCTGGCCCACGGGCTGGCTTTGGGGCTCGTGATT GCCACGCTGGGGAATATCAGTGGTGGACACTTCAACCCTGCGGTGTCCCTGGCAGCCATG CTGATCGGAGGCCTCAACCTGGTGATGCTCCTCCCGTACTGGGTCTCACAGCTGCTCGGG GGGATGCTCGGGGCTGCCTTGGCCAAGGCGGTGAGTCCTGAGGAGAGGTTCTGGAATGCA TCTGGGGCGGCCTTTGTGACAGTCCAGGAGCAGGGGCAGGTGGCAGGGGCGTTGGTGGCA GAGATCATCCTGACGACGCTGCTGGCCCTGGCTGTATGCATGGGTGCCATCAATGAGAAG ACAAAGGGCCCTCTGGCCCCGTTCTCCATCGGCTTTGCCGTCACCGTGGATATCCTGGCT GGGGGCCCTGTGTCTGGAGGCTGCATGAATCCCGCCCGTGCTTTTGGACCTGCGGTGGTG GCCAACCACTGGAACTTCCACTGGATCTACTGGCTGGGCCCACTCCTGGCTGGCCTGCTT GTTGGACTGCTCATTAGGTGCTTCATTGGAGATGGGAAGACCCGCCTCATCCTGAAGGCT CGGTGA |
Restriction Sites | Please inquire |
ACCN | NM_001169 |
Insert Size | 800 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_001169.2. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_001169.2, NP_001160.2 |
RefSeq Size | 1315 bp |
RefSeq ORF | 786 bp |
Locus ID | 343 |
UniProt ID | O94778 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | Aquaporin 8 (AQP8) is a water channel protein. Aquaporins are a family of small integral membrane proteins related to the major intrinsic protein (MIP or AQP0). Aquaporin 8 mRNA is found in pancreas and colon but not other tissues. [provided by RefSeq, Jul 2008] |
Citations (2)
The use of this cDNA Clones has been cited in the following citations: |
---|
Intracellular cysteine oxidation is modulated by aquaporin-8-mediated hydrogen peroxide channeling in leukaemia cells
,Vieceli Dalla Sega, F;Prata, C;Zambonin, L;Angeloni, C;Rizzo, B;Hrelia, S;Fiorentini, D;,
Biofactors
,PubMed ID 27862460
[AQP8]
|
Aquaporin-3 mediates hydrogen peroxide uptake to regulate downstream intracellular signaling
,Evan W. Miller, Bryan C. Dickinson, and Christopher J. Chang,
PNAS, Sep 2010; 107: 15681 - 15686
[AQP8]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC219668 | AQP8 (Myc-DDK-tagged)-Human aquaporin 8 (AQP8) |
CNY 2,400.00 |
|
RC219668L3 | Lenti ORF clone of Human aquaporin 8 (AQP8), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC219668L4 | Lenti ORF clone of Human aquaporin 8 (AQP8), mGFP tagged |
CNY 5,890.00 |
|
RG219668 | AQP8 (tGFP-tagged) - Human aquaporin 8 (AQP8) |
CNY 4,000.00 |
其它Aquaporin 8产品