GTF3A (NM_002097) Human Untagged Clone
CAT#: SC303118
GTF3A (untagged)-Human general transcription factor IIIA (GTF3A)
CNY 5,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | AP2; TFIIIA |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_002097 edited
CTGGATCCGCCGGCCGTGGTCGCCGAGTCGGTGTCGTCCTTGACCATCGCCGACGCGTTC ATTGCAGCCGGCGAGAGCTCAGCTCCGACCCCGCCGCGCCCCGCGCTTCCCAGGAGGTTC ATCTGCTCCTTCCCTGACTGCAGCGCCAATTACAGCAAAGCCTGGAAGCTTGACGCGCAC CTGTGCAAGCACACGGGGGAGAGACCATTTGTTTGTGACTATGAAGGGTGTGGCAAGGCC TTCATCAGGGACTACCATCTGAGCCGCCACATTCTGACTCACACAGGAGAAAAGCCGTTT GTTTGTGCAGCCAATGGCTGTGATCAAAAATTCAACACAAAATCAAACTTGAAGAAACAT TTTGAACGCAAACATGAAAATCAACAAAAACAATATATATGCAGTTTTGAAGACTGTAAG AAGACCTTTAAGAAACATCAGCAGCTGAAAATCCATCAGTGCCAGCATACCAATGAACCT CTATTCAAGTGTACCCAGGAAGGATGTGGGAAACACTTTGCATCACCCAGCAAGCTGAAA CGACATGCCAAGGCCCACGAGGGCTATGTATGTCAAAAAGGATGTTCCTTTGTGGCAAAA ACATGGACGGAACTTCTGAAACATGTGAGAGAAACCCATAAAGAGGAAATACTATGTGAA GTATGCCGGAAAACATTTAAACGCAAAGATTACCTTAAGCAACACATGAAAACTCATGCC CCAGAAAGGGATGTATGTCGCTGTCCAAGAGAAGGCTGTGGAAGAACCTATACAACTGTG TTTAATCTCCAAAGCCATATCCTCTCCTTCCATGAGGAAAGCCGCCCTTTTGTGTGTGAA CATGCTGGCTGTGGCAAAACATTTGCAATGAAACAAAGTCTCACTAGGCATGCTGTTGTA CATGATCCTGACAAGAAGAAAATGAAGCTCAAAGTCAAAAAATCTCGTGAAAAACGGAGT TTGGCCTCTCATCTCAGTGGATATATCCCTCCCAAAAGGAAACAAGGGCAAGGCTTATCT TTGTGTCAAAACGGAGAGTCACCCAACTGTGTGGAAGACAAGATGCTCTCGACAGTTGCA GTACTTACCCTTGGCTAA |
Restriction Sites | Please inquire |
ACCN | NM_002097 |
Insert Size | 1400 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_002097.1, NP_002088.1 |
RefSeq Size | 1381 bp |
RefSeq ORF | 1272 bp |
Locus ID | 2971 |
UniProt ID | Q92664 |
Protein Families | Transcription Factors |
Gene Summary | The product of this gene is a zinc finger protein with nine Cis[2]-His[2] zinc finger domains. It functions as an RNA polymerase III transcription factor to induce transcription of the 5S rRNA genes. The protein binds to a 50 bp internal promoter in the 5S genes called the internal control region (ICR), and nucleates formation of a stable preinitiation complex. This complex recruits the TFIIIC and TFIIIB transcription factors and RNA polymerase III to form the complete transcription complex. The protein is thought to be translated using a non-AUG translation initiation site in mammals based on sequence analysis, protein homology, and the size of the purified protein. [provided by RefSeq, Jul 2008] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225554 | GTF3A (Myc-DDK-tagged)-Human general transcription factor IIIA (GTF3A) |
CNY 3,656.00 |
|
RC225554L3 | Lenti ORF clone of Human general transcription factor IIIA (GTF3A), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC225554L4 | Lenti ORF clone of Human general transcription factor IIIA (GTF3A), mGFP tagged |
CNY 5,890.00 |
|
RG225554 | GTF3A (tGFP-tagged) - Human general transcription factor IIIA (GTF3A) |
CNY 4,370.00 |