NTH1 (NTHL1) (NM_002528) Human Untagged Clone
CAT#: SC303213
NTHL1 (untagged)-Human nth endonuclease III-like 1 (E. coli) (NTHL1)
CNY 2,400.00
CNY 6,270.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | FAP3; hNTH1; NTH1; OCTS3 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_002528 edited
GGGATGTGTAGTCCGCAGGAGTCCGGCATGACCGCCTTGAGCGCGAGGATGCTGACCCGG AGCCGGAGCCTGGGACCCGGGGCTGGGCCGCGGGGGTGTAGGGAGGAGCCCGGGCCTCTC CGGAGAAGAGAGGCTGCAGCAGAAGCGAGGAAAAGCCACAGCCCCGTGAAGCGTCCGCGG AAAGCACAGAGACTGCGTGTGGCCTATGAGGGCTCGGACAGTGAGAAAGGTGAGGGGGCT GAGCCCCTCAAGGTGCCAGTCTGGGAGCCCCAGGACTGGCAGCAACAGCTGGTCAACATC CGTGCCATGAGGAACAAAAAGGATGCACCTGTGGACCATCTGGGGACTGAGCACTGCTAT GACTCCAGTGCCCCCCCAAAGGTACGCAGGTACCAGGTGCTGCTGTCACTGATGCTCTCC AGCCAAACCAAAGACCAGGTGACGGCGGGCGCCATGCAGCGACTGCGGGCGCGGGGCCTG ACGGTGGACAGCATCCTGCAGACAGATGATGCCACGCTGGGCAAGCTCATCTACCCCGTC GGTTTCTGGAGGAGCAAGGTGAAATACATCAAGCAGACCAGCGCCATCCTGCAGCAGCAC TACGGTGGGGACATCCCAGCCTCTGTGGCCGAGCTGGTGGCGCTGCCGGGTGTTGGGCCC AAGATGGCACACCTGGCTATGGCTGTGGCCTGGGGCACTGTGTCAGGCATTGCAGTGGAC ACGCATGTGCACAGAATCGCCAACAGGCTGAGGTGGACCAAGAAGGCAACCAAGTCCCCA GAGGAGACCCGCGCCGCCCTGGAGGAGTGGCTGCCTAGGGAGCTGTGGCACGAGATCAAT GGACTCTTGGTGGGCTTCGGCCAGCAGACCTGTCTGCCTGTGCACCCTCGCTGCCACGCC TGCCTCAACCAAGCCCTCTGCCCGGCCGCCCAGGGTCTCTGATGGCCGCATGGCTCTGGC CGAGGTGCCGCTGTGGCCACCGTCTGTGAAGTGGCTTTACGCTTCAGGAAGCCACGCCTG TTGAATAAAGCTTTGGTGTGTTTGCAAAAAAAAAAAAAAAAAA |
Restriction Sites | Please inquire |
ACCN | NM_002528 |
Insert Size | 1100 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_002528.4. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_002528.4, NP_002519.1 |
RefSeq Size | 1097 bp |
RefSeq ORF | 939 bp |
Locus ID | 4913 |
UniProt ID | P78549 |
Protein Families | Druggable Genome, Stem cell - Pluripotency |
Protein Pathways | Base excision repair |
Gene Summary | The protein encoded by this gene is a DNA N-glycosylase of the endonuclease III family. Like a similar protein in E. coli, the encoded protein has DNA glycosylase activity on DNA substrates containing oxidized pyrimidine residues and has apurinic/apyrimidinic lyase activity. [provided by RefSeq, Oct 2008] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). CCDS Note: The coding region has been updated to shorten the N-terminus to one that is more supported by conservation. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC214598 | NTHL1 (Myc-DDK-tagged)-Human nth endonuclease III-like 1 (E. coli) (NTHL1) |
CNY 2,400.00 |
|
RC214598L3 | Lenti ORF clone of Human nth endonuclease III-like 1 (E. coli) (NTHL1), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC214598L4 | Lenti ORF clone of Human nth endonuclease III-like 1 (E. coli) (NTHL1), mGFP tagged |
CNY 5,890.00 |
|
RG214598 | NTHL1 (tGFP-tagged) - Human nth endonuclease III-like 1 (E. coli) (NTHL1) |
CNY 4,000.00 |