United States
Germany
Japan
United Kingdom
China
RGS13 (NM_002927) Human Untagged Clone
CAT＃: SC303252
RGS13 (untagged)-Human regulator of G-protein signaling 13 (RGS13), transcript variant 1
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC303252 representing NM_002927.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAGCAGGCGGAATTGTTGGATTTGTAAGATGTGCAGAGATGAATCTAAGAGGCCCCCTTCAAACCTT ACTTTGGAGGAAGTATTACAGTGGGCCCAGTCTTTTGAAAATTTAATGGCTACAAAATATGGTCCAGTA GTCTATGCAGCATATTTAAAAATGGAGCACAGTGACGAGAATATTCAATTCTGGATGGCATGTGAAACC TATAAGAAAATTGCCTCACGGTGGAGCAGAATTTCTAGGGCAAAGAAGCTTTATAAGATTTACATCCAG CCACAGTCCCCTAGAGAGATTAACATTGACAGTTCGACAAGAGAGACTATCATCAGGAACATTCAGGAA CCCACTGAAACATGTTTTGAAGAAGCTCAGAAAATAGTCTATATGCATATGGAAAGGGATTCCTACCCC AGATTTCTAAAGTCAGAAATGTACCAAAAACTTTTGAAAACTATGCAGTCCAACAACAGTTTCTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_002927 |
| Insert Size | 480 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_002927.4 |
| RefSeq Size | 1578 bp |
| RefSeq ORF | 480 bp |
| Locus ID | 6003 |
| UniProt ID | O14921 |
| Protein Families | Druggable Genome |
| MW | 19.1 kDa |
| Gene Summary | The protein encoded by this gene is a member of the regulator of G protein signaling (RGS) family. RGS family members share similarity with S. cerevisiae SST2 and C. elegans egl-10 proteins, which contain a characteristic conserved RGS domain. RGS proteins accelerate GTPase activity of G protein alpha-subunits, thereby driving G protein into their inactive GDP-bound form, thus negatively regulating G protein signaling. RGS proteins have been implicated in the fine tuning of a variety of cellular events in response to G protein-coupled receptor activation. The biological function of this gene, however, is unknown. Two transcript variants encoding the same isoform exist. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) represents the longer transcript. Sequence Note: The RefSeq transcript and protein were derived from genomic sequence to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC208904 | RGS13 (Myc-DDK-tagged)-Human regulator of G-protein signaling 13 (RGS13), transcript variant 1 |
CNY 1,200.00 |
|
| RC208904L3 | Lenti ORF clone of Human regulator of G-protein signaling 13 (RGS13), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC208904L4 | Lenti ORF clone of Human regulator of G-protein signaling 13 (RGS13), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
| RG208904 | RGS13 (tGFP-tagged) - Human regulator of G-protein signaling 13 (RGS13), transcript variant 1 |
CNY 2,800.00 |
