HMGA2 (NM_003484) Human Untagged Clone
CAT#: SC303314
HMGA2 (untagged)-Human high mobility group AT-hook 2 (HMGA2), transcript variant 2
CNY 1,200.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BABL; HMGI-C; HMGIC; LIPO; SRS5; STQTL9 |
Vector | pCMV6-AC |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>OriGene ORF sequence for NM_003484 edited
ATGAGCGCACGCGGTGAGGGCGCGGGGCAGCCGTCCACTTCAGCCCAGGGACAACCTGCC GCCCCAGCGCCTCAGAAGAGAGGACGCGGCCGCCCCAGGAAGCAGCAGCAAGAACCAACC GGTGAGCCCTCTCCTAAGAGACCCAGGGGAAGACCCAAAGGCAGCAAAAACAAGAGTCCC TCTAAAGCAGCTCAAAAGAAAGCAGAAGCCACTGGAGAAAAACGGCCAAGAGGCAGACCT AGGAAATGGGACAATCTACTACCAAGAACCAGCTCCAAGAAGAAAACATCTCTGGGAAAC AGTACCAAAAGGAGTCACACGCGTTAA |
Restriction Sites | Please inquire |
ACCN | NM_003484 |
Insert Size | 300 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_003484.1, NP_003475.1 |
RefSeq Size | 1539 bp |
RefSeq ORF | 321 bp |
Locus ID | 8091 |
UniProt ID | P52926 |
Protein Families | Druggable Genome |
Gene Summary | This gene encodes a protein that belongs to the non-histone chromosomal high mobility group (HMG) protein family. HMG proteins function as architectural factors and are essential components of the enhancesome. This protein contains structural DNA-binding domains and may act as a transcriptional regulating factor. Identification of the deletion, amplification, and rearrangement of this gene that are associated with myxoid liposarcoma suggests a role in adipogenesis and mesenchymal differentiation. A gene knock out study of the mouse counterpart demonstrated that this gene is involved in diet-induced obesity. Alternate transcriptional splice variants, encoding different isoforms, have been characterized. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) differs in the 3' structure, resulting in a novel 3' coding region and 3' UTR, compared to variant 1. The encoded isoform (b) has a distinct C-terminus, and is shorter, compared to isoform a. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC214681 | HMGA2 (Myc-DDK-tagged)-Human high mobility group AT-hook 2 (HMGA2), transcript variant 2 |
CNY 1,200.00 |
|
RC214681L3 | Lenti ORF clone of Human high mobility group AT-hook 2 (HMGA2), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC214681L4 | Lenti ORF clone of Human high mobility group AT-hook 2 (HMGA2), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG214681 | HMGA2 (tGFP-tagged) - Human high mobility group AT-hook 2 (HMGA2), transcript variant 2 |
CNY 2,800.00 |