United States
Germany
Japan
United Kingdom
China
Uroplakin Ia (UPK1A) (NM_007000) Human Untagged Clone
CAT＃: SC303865
UPK1A (untagged)-Human uroplakin 1A (UPK1A)
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | TSPAN21; UP1A; UPIA; UPKA |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>OriGene sequence for NM_007000 edited
ATGGCGTCTGCGGCAGCAGCGGAGGCCGAGAAGGGATCTCCAGTTGTGGTGGGCCTGCTA GTTGTGGGCAATATCATTATTCTGCTGTCAGGCCTGTCCCTGTTTGCTGAGACCATATGG GTGACAGCCGACCAGTACCGTGTATACCCACTGATGGGAGTCTCAGGCAAGGATGACGTC TTCGCTGGTGCCTGGATTGCCATCTTCTGCGGCTTCTCCTTCTTCATGGTAGCCAGTTTT GGTGTGGGTGCCGCACTCTGCCGCCGCCGGTCCATGGTCCTCACGTACCTGGTGCTCATG CTCATCGTCTACATCTTCGAGTGCGCCTCCTGCATCACGTCCTACACCCACCGTGACTAC ATGGTGTCCAACCCATCCCTGATCACCAAGCAGATGCTGACCTTCTACAGCGCGGACACC GACCAGGGCCAGGAGCTGACCCGCCTCTGGGACCGCGTCATGATTGAGCAAGAATGCTGT GGCACATCTGGTCCCATGGACTGGGTGAACTTCACGTCAGCCTTCCGGGCGGCCACTCCG GAGGTGGTGTTCCCCTGGCCCCCACTGTGCTGTCGCCGGACGGGAAACTTCATCCCCCTC AACGAGGAGGGCTGCCGCCTGGGGCACATGGACTACCTGTTCACCAAGGGCTGCTTCGAA CACATCGGCCACGCCATCGACAGCTACACGTGGGGTATCTCGTGGTTTGGGTTTGCCATC CTGATGTGGACGCTCCCGGTCATGCTGATAGCCATGTATTTCTACACCATGCTCTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_007000 |
| Insert Size | 800 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_007000.2, NP_008931.1 |
| RefSeq Size | 1223 bp |
| RefSeq ORF | 777 bp |
| Locus ID | 11045 |
| UniProt ID | O00322 |
| Protein Families | Transmembrane |
| Gene Summary | The protein encoded by this gene is a member of the transmembrane 4 superfamily, also known as the tetraspanin family. Most of these members are cell-surface proteins that are characterized by the presence of four hydrophobic domains. The proteins mediate signal transduction events that play a role in the regulation of cell development, activation, growth and motility. This encoded protein is found in the asymmetrical unit membrane (AUM) where it can complex with other transmembrane 4 superfamily proteins. It may play a role in normal bladder epithelial physiology, possibly in regulating membrane permeability of superficial umbrella cells or in stabilizing the apical membrane through AUM/cytoskeletal interactions. The protein may also play a role in tumor suppression. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013] Transcript Variant: This variant (1) encodes isoform 1. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC215087 | UPK1A (Myc-DDK-tagged)-Human uroplakin 1A (UPK1A) |
CNY 2,400.00 |
|
| RC215087L1 | Lenti ORF clone of Human uroplakin 1A (UPK1A), Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC215087L2 | Lenti ORF clone of Human uroplakin 1A (UPK1A), mGFP tagged |
CNY 5,890.00 |
|
| RC215087L3 | Lenti ORF clone of Human uroplakin 1A (UPK1A), Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC215087L4 | Lenti ORF clone of Human uroplakin 1A (UPK1A), mGFP tagged |
CNY 5,890.00 |
|
| RG215087 | UPK1A (tGFP-tagged) - Human uroplakin 1A (UPK1A) |
CNY 4,000.00 |
其它Uroplakin Ia产品
