Homeobox protein SIX6 (SIX6) (NM_007374) Human Untagged Clone

CAT#: SC303921

SIX6 (untagged)-Human SIX homeobox 6 (SIX6)



  "NM_007374" in other vectors (4)

CNY 2,400.00

CNY 3,990.00


货期*
现货

规格
    • 10 ug

Product images

经常一起买 (4)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00


Rabbit polyclonal anti-SIX6 antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms MCOPCT2; ODRMD; OPTX2; Six9
Vector pCMV6-XL5
E. coli Selection Ampicillin (100 ug/mL)
Mammalian Cell Selection None
Sequence Data
>OriGene sequence for NM_007374 edited
TGGCGCACTCAGCCAGGCCCGCGGGCATCTGCTGCGTGTCCCGCTCCGGGCTCAGTGCCC
TCGCCGCCGCCGGCACTGCCTCGATGTTCCAGCTGCCCATCTTGAATTTCAGCCCCCAGC
AAGTGGCCGGGGTATGTGAGACCCTGGAAGAGAGCGGCGATGTGGAGCGCCTGGGTCGCT
TCCTCTGGTCGCTGCCCGTGGCCCCTGCGGCCTGCGAGGCCCTCAACAAGAATGAGTCGG
TGCTACGCGCACGAGCCATCGTGGCCTTTCACGGTGGCAACTACCGCGAGCTCTATCATA
TCCTGGAAAACCACAAGTTCACCAAGGAGTCGCACGCCAAGCTGCAGGCGCTGTGGCTTG
AAGCACACTACCAGGAGGCTGAGAAGCTGCGTGGAAGACCCCTGGGACCTGTGGACAAGT
ACCGAGTAAGGAAGAAGTTCCCGCTGCCGCGCACCATTTGGGACGGCGAACAGAAGACAC
ACTGCTTCAAGGAGCGCACGCGGAACCTGCTACGCGAGTGGTACCTGCAGGATCCATACC
CTAACCCCAGCAAAAAACGTGAGCTCGCCCAGGCAACCGGACTGACCCCTACGCAGGTGG
GCAACTGGTTCAAAAACCGCCGACAAAGGGACCGAGCGGCTGCAGCCAAGAACAGACTCC
AGCAGCAGGTCCTGTCACAGGGTTCCGGGCGGGCACTACGGGCGGAGGGCGACGGCACGC
CAGAGGTGCTGGGCGTCGCCACCAGCCCGGCCGCCAGTCTATCCAGCAAGGCGGCCACTT
CAGCCATCTCCATCACGTCCAGCGACAGCGAGTGCGACATCTGAGTTGCCCATCCAGGAT
GCTCAGAAGCAGATTCCAGTGTAAAAACGAGAAAAACAAAATGAAAGAGGGGAAGAAGAT
GAGAGACCTGCAA
Restriction Sites Please inquire     
ACCN NM_007374
Insert Size 900 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation The ORF of this clone has been fully sequenced and found to be a perfect match to NM_007374.1.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_007374.1, NP_031400.1
RefSeq Size 1391 bp
RefSeq ORF 741 bp
Locus ID 4990
UniProt ID O95475
Gene Summary The protein encoded by this gene is a homeobox protein that is similar to the Drosophila 'sine oculis' gene product. This gene is found in a cluster of related genes on chromosome 14 and is thought to be involved in eye development. Defects in this gene are a cause of isolated microphthalmia with cataract type 2 (MCOPCT2). [provided by RefSeq, Jul 2008]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...