IL36 alpha (IL36A) (NM_014440) Human Untagged Clone
CAT#: SC304107
IL36A (untagged)-Human interleukin 1 family, member 6 (epsilon) (IL1F6)
CNY 1,200.00
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | FIL1; FIL1(EPSILON); FIL1E; IL-1F6; IL1(EPSILON); IL1F6 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>NCBI ORF sequence for NM_014440, the custom clone sequence may differ by one or more nucleotides
ATGGAAAAAGCATTGAAAATTGACACACCTCAGCAGGGGAGCATTCAGGATATCAATCATCGGGTGTGGG TTCTTCAGGACCAGACGCTCATAGCAGTCCCGAGGAAGGACCGTATGTCTCCAGTCACTATTGCCTTAAT CTCATGCCGACATGTGGAGACCCTTGAGAAAGACAGAGGGAACCCCATCTACCTGGGCCTGAATGGACTC AATCTCTGCCTGATGTGTGCTAAAGTCGGGGACCAGCCCACACTGCAGCTGAAGGAAAAGGATATAATGG ATTTGTACAACCAACCCGAGCCTGTGAAGTCCTTTCTCTTCTACCACAGCCAGAGTGGCAGGAACTCCAC CTTCGAGTCTGTGGCTTTCCCTGGCTGGTTCATCGCTGTCAGCTCTGAAGGAGGCTGTCCTCTCATCCTT ACCCAAGAACTGGGGAAAGCCAACACTACTGACTTTGGGTTAACTATGCTGTTTTAA |
Restriction Sites | Please inquire |
ACCN | NM_014440 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_014440.1, NP_055255.1 |
RefSeq Size | 477 bp |
RefSeq ORF | 477 bp |
Locus ID | 27179 |
UniProt ID | Q9UHA7 |
Protein Families | Druggable Genome, Secreted Protein |
Gene Summary | The protein encoded by this gene is a cytokine that can activate NF-kappa-B and MAPK signaling pathways to generate an inflammatory response. The encoded protein functions primarily in skin and demonstrates increased expression in psoriasis. In addition, decreased expression of this gene has been linked to a poor prognosis in both hepatocellular carcinoma and colorectal cancer patients. [provided by RefSeq, Nov 2015] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC219328 | IL36A (Myc-DDK-tagged)-Human interleukin 1 family, member 6 (epsilon) (IL1F6) |
CNY 1,200.00 |
|
RC219328L3 | Lenti ORF clone of Human interleukin 1 family, member 6 (epsilon) (IL1F6), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC219328L4 | Lenti ORF clone of Human interleukin 1 family, member 6 (epsilon) (IL1F6), mGFP tagged |
CNY 5,890.00 |
|
RG219328 | IL36A (tGFP-tagged) - Human interleukin 1 family, member 6 (epsilon) (IL1F6) |
CNY 2,800.00 |
其它IL36 alpha产品