United States
Germany
Japan
United Kingdom
China
ECE2 (EEF1AKMT4) (NM_032331) Human Untagged Clone
CAT＃: SC305434
ECE2 (untagged)-Human endothelin converting enzyme 2 (ECE2), transcript variant 3
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Vector | pCMV6 series |
| Sequence Data |
>NCBI ORF sequence for NM_032331, the custom clone sequence may differ by one or more nucleotides
ATGGCCTCTCCAGGGGCAGGTAGGGCGCCTCCGGAGTTACCGGAGCGGAACTGCGGGTAC CGCGAAGTCGAGTACTGGGATCAGCGCTACCAAGGCGCAGCCGATTCTGCCCCCTACGAT TGGTTCGGGGACTTCTCCTCCTTCCGTGCCCTCCTAGAGCCGGAGCTGCGGCCCGAGGAC CGTATCCTTGTGCTAGGTTGCGGGAACAGTGCCCTGAGCTACGAGCTGTTCCTCGGAGGC TTCCCTAATGTGACCAGTGTGGACTACTCATCAGTCGTGGTGGCTGCCATGCAGGCTCGC CATGCCCATGTGCCGCAGCTGCGCTGGGAGACCATGGATGTGCGGAAGCTGGACTTCCCC AGTGCTTCTTTTGATGTGGTGCTCGAGAAGGGCACGCTGGATGCCCTGCTGGCTGGGGAA CGAGATCCCTGGACCGTGTCCTCTGAAGGTGTCCACACTGTGGACCAGGTGTTGAGTGAG GTGAGCCGCGTGCTTGTCCCTGGAGGCCGGTTTATCTCAATGACTTCTGCTGCCCCCCAC TTTCGGACCAGACACTATGCCCAAGCCTATTATGGCTGGTCCCTGAGGCATGCTACCTAT GGCAGCGGTTTCCACTTCCATCTCTACCTCATGCACAAGGGCGGGAAGCTCAGTGTGGCC CAGCTGGCTCTGGGGGCCCAAATCCTCTCACCCCCCAGACCTCCCACCTCACCTTGCTTC CTTCAGGACTCAGATCATGAGGACTTCCTTAGTGCCATTCAGCTCTGA |
| Restriction Sites | Please inquire |
| ACCN | NM_032331 |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_032331.2, NP_115707.1 |
| RefSeq Size | 1052 bp |
| RefSeq ORF | 768 bp |
| Locus ID | 110599564 |
| UniProt ID | P0DPD7 |
| Gene Summary | This gene encodes a member of the lysine-specific methyltransferase (KMT) family. The encoded enzyme catalyzes the methylation of lysine-36 of the eukaryotic translation elongation factor 1 alpha. Methylation by this enzyme may affect endoplasmic reticulum-related processes. [provided by RefSeq, Jul 2017] Transcript Variant: This variant (3) differs in the 3' UTR and CDS compared to variant 1. The resulting isoform (C) has a distinct C-terminus compared to isoform A. Isoform C lacks the zinc-binding site and peptidase domain of canonical endothelin-converting enzymes and like |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC214910 | ECE2 (Myc-DDK-tagged)-Human endothelin converting enzyme 2 (ECE2), transcript variant 3 |
CNY 3,990.00 |
|
| RC214910L3 | Lenti-ORF clone of ECE2 (Myc-DDK-tagged)-Human endothelin converting enzyme 2 (ECE2), transcript variant 3 |
CNY 5,890.00 |
|
| RC214910L4 | Lenti-ORF clone of ECE2 (mGFP-tagged)-Human endothelin converting enzyme 2 (ECE2), transcript variant 3 |
CNY 5,890.00 |
|
| RG214910 | ECE2 (tGFP-tagged) - Human endothelin converting enzyme 2 (ECE2), transcript variant 3 |
CNY 4,370.00 |
其它EEF1AKMT4产品
