Ovary specific acidic protein (MGARP) (NM_032623) Human Untagged Clone

CAT#: SC305491

MGARP (untagged)-Human chromosome 4 open reading frame 49 (C4orf49)



  "NM_032623" in other vectors (6)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
MGARP mouse monoclonal antibody,clone OTI5B6
    • 100 ul

CNY 1,999.00
CNY 2,700.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms C4orf49; CESP-1; HUMMR; OSAP
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC305491 representing NM_032623.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTATCTCCGCAGGGCGGTCTCCAAGACTCTGGCGCTGCCGCTGAGGGCGCCCCCCAACCCCGCGCCG
CTCGGAAAGGACGCATCTCTGCGCCGGATGTCATCTAACAGATTCCCTGGATCATCTGGATCAAATATG
ATTTATTATCTGGTTGTAGGCGTCACAGTCAGTGCTGGTGGATATTATGCTTACAAGACAGTCACATCA
GACCAAGCCAAACACACAGAACATAAAACAAATTTGAAAGAAAAAACAAAAGCAGAGATACATCCATTT
CAAGGTGAAAAGGAGAATGTTGCGGAAACTGAGAAAGCAAGTTCAGAAGCCCCAGAAGAACTTATAGTG
GAAGCTGAGGTGGTAGATGCTGAAGAAAGTCCCAGTGCTACAGTTGTGGTCATAAAAGAGGCATCTGCC
TGTCCAGGTCACGTGGAGGCTGCTCCGGAGACCACAGCAGTCAGTGCTGAAACCGGGCCAGAGGTCACA
GATGCAGCGGCGAGGGAAACCACGGAAGTAAACCCTGAAACAACCCCAGAGGTTACAAATGCTGCCCTG
GATGAAGCTGTCACCATCGATAATGATAAAGATACAACAAAGAACGAAACCTCTGATGAATATGCTGAA
CTAGAAGAAGAAAATTCTCCAGCTGAGTCAGAGTCCTCTGCTGGAGATGATTTACAGGAGGAAGCCAGT
GTTGGCTCTGAGGCTGCTTCGGCTCAAGGCTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_032623
Insert Size 723 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_032623.3
RefSeq Size 1339 bp
RefSeq ORF 723 bp
Locus ID 84709
UniProt ID Q8TDB4
Protein Families Transmembrane
MW 25.4 kDa
Gene Summary Plays a role in the trafficking of mitochondria along microtubules. Regulates the kinesin-mediated axonal transport of mitochondria to nerve terminals along microtubules during hypoxia. Participates in the translocation of TRAK2/GRIF1 from the cytoplasm to the mitochondrion. Also plays a role in steroidogenesis through maintenance of mitochondrial abundance and morphology (By similarity).[UniProtKB/Swiss-Prot Function]
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

其它Ovary specific acidic protein产品

Customer Reviews 
Loading...