PDGF AA (PDGFA) (NM_033023) Human Untagged Clone
CAT#: SC305534
PDGFA (untagged)-Human platelet-derived growth factor alpha polypeptide (PDGFA), transcript variant 2
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | PDGF-A; PDGF1 |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC305534 representing NM_033023.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAGGACCTTGGCTTGCCTGCTGCTCCTCGGCTGCGGATACCTCGCCCATGTTCTGGCCGAGGAAGCC GAGATCCCCCGCGAGGTGATCGAGAGGCTGGCCCGCAGTCAGATCCACAGCATCCGGGACCTCCAGCGA CTCCTGGAGATAGACTCCGTAGGGAGTGAGGATTCTTTGGACACCAGCCTGAGAGCTCACGGGGTCCAT GCCACTAAGCATGTGCCCGAGAAGCGGCCCCTGCCCATTCGGAGGAAGAGAAGCATCGAGGAAGCTGTC CCCGCTGTCTGCAAGACCAGGACGGTCATTTACGAGATTCCTCGGAGTCAGGTCGACCCCACGTCCGCC AACTTCCTGATCTGGCCCCCGTGCGTGGAGGTGAAACGCTGCACCGGCTGCTGCAACACGAGCAGTGTC AAGTGCCAGCCCTCCCGCGTCCACCACCGCAGCGTCAAGGTGGCCAAGGTGGAATACGTCAGGAAGAAG CCAAAATTAAAAGAAGTCCAGGTGAGGTTAGAGGAGCATTTGGAGTGCGCCTGCGCGACCACAAGCCTG AATCCGGATTATCGGGAAGAGGACACGGATGTGAGGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_033023 |
Insert Size | 591 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_033023.4 |
RefSeq Size | 2740 bp |
RefSeq ORF | 591 bp |
Locus ID | 5154 |
UniProt ID | P04085 |
Protein Families | Druggable Genome |
Protein Pathways | Cytokine-cytokine receptor interaction, Focal adhesion, Gap junction, Glioma, MAPK signaling pathway, Melanoma, Pathways in cancer, Prostate cancer, Regulation of actin cytoskeleton |
MW | 22.3 kDa |
Gene Summary | This gene encodes a member of the protein family comprised of both platelet-derived growth factors (PDGF) and vascular endothelial growth factors (VEGF). The encoded preproprotein is proteolytically processed to generate platelet-derived growth factor subunit A, which can homodimerize, or alternatively, heterodimerize with the related platelet-derived growth factor subunit B. These proteins bind and activate PDGF receptor tyrosine kinases, which play a role in a wide range of developmental processes. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015] Transcript Variant: This variant (2) lacks exon 6, compared to variant 1, and encodes the shorter isoform (2). Sequence Note: This RefSeq record was created from transcript and genomic sequence data because no single transcript was available for the full length of the gene. The extent of this transcript is supported by transcript alignments and experimental evidence. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC214164 | PDGFA (Myc-DDK-tagged)-Human platelet-derived growth factor alpha polypeptide (PDGFA), transcript variant 2 |
CNY 2,400.00 |
|
RC214164L1 | Lenti ORF clone of Human platelet-derived growth factor alpha polypeptide (PDGFA), transcript variant 2, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC214164L2 | Lenti ORF clone of Human platelet-derived growth factor alpha polypeptide (PDGFA), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RC214164L3 | Lenti ORF clone of Human platelet-derived growth factor alpha polypeptide (PDGFA), transcript variant 2, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC214164L4 | Lenti ORF clone of Human platelet-derived growth factor alpha polypeptide (PDGFA), transcript variant 2, mGFP tagged |
CNY 4,800.00 |
|
RG214164 | PDGFA (tGFP-tagged) - Human platelet-derived growth factor alpha polypeptide (PDGFA), transcript variant 2 |
CNY 4,370.00 |
其它PDGF AA产品