SLAMF9 (NM_033438) Human Untagged Clone
CAT#: SC305634
SLAMF9 (untagged)-Human SLAM family member 9 (SLAMF9), transcript variant 1
CNY 6,270.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | CD2F-10; CD2F10; CD84-H1; CD84H1; SF2001 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_033438 edited
ACTGAATCACACCTCTGGGGCTGGGGGCTGCTGACATGTGTGCCTTTCCTTGGCTGCTTC TTCTCCTGCTGCTCCAGGAGGGCAGCCAAAGGAGACTCTGGAGATGGTGTGGATCCGAGG AAGTGGTTGCGGTCCTTCAGGAGTCCATCAGCCTCCCCCTGGAAATACCACCAGATGAAG AGGTTGAGAACATCATCTGGTCCTCTCACAAAAGTCTTGCCACTGTGGTGCCAGGGAAAG AGGGACATCCAGCTACCATCATGGTGACCAATCCACACTACCAGGGCCAAGTGAGCTTCC TGGACCCCAGCTATTCCCTGCATATCAGCAATCTGAGCTGGGAGGATTCAGGGCTTTACC AAGCTCAAGTCAACCTGAGAACATCCCAGATCTCTACCATGCAGCAGTACAATCTATGTG TCTACCGATGGCTGTCAGAGCCCCAGATCACTGTGAACTTTGAGAGTTCTGGGGAAGGTG CCTGCAGTATGTCCCTGGTGTGCTCTGTGGAGAAGGCAGGCATGGATATGACCTACAGCT GGCTCTCCCGGGGGGATAGCACTTATACATTCCATGAAGGCCCTGTCCTCAGCACATCCT GGAGGCCGGGGGACAGTGCCCTCTCCTACACCTGCAGAGCCAACAACCCCATCAGCAACG TCAGTTCTTGCCCCATCCCTGATGGGCCCTTCTATGCAGATCCTAACTATGCTTCTGAGA AGCCTTCAACAGCCTTCTGCCTCCTGGCCAAGGGATTGCTCATCTTCTTGCTCTTGGTAA TTCTGGCCATGGGACTCTGGGTCATCCGAGTCCAGAAAAGACACAAAATGCCAAGGATGA AGAAACTCATGAGAAACAGAATGAAATTGAGGAAGGAGGCAAAGCCTGGCTCCAGCCCTG CCTGACTGCTCCTTGGGAACCCCAGTCCTGAGCTTGGTTTC |
Restriction Sites | Please inquire |
ACCN | NM_033438 |
Insert Size | 940 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to be a perfect match to NM_033438.1. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_033438.1, NP_254273.1 |
RefSeq Size | 1139 bp |
RefSeq ORF | 870 bp |
Locus ID | 89886 |
UniProt ID | Q96A28 |
Protein Families | Druggable Genome, Transmembrane |
Gene Summary | This gene encodes a member of the signaling lymphocytic activation molecule family. The encoded protein is a cell surface molecule that consists of two extracellular immunoglobulin domains, a transmembrane domain and a short cytoplasmic tail that lacks the signal transduction motifs found in other family members. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Apr 2009] Transcript Variant: This variant (1) represents the longest transcript and encodes the longest isoform (1). |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC210366 | SLAMF9 (Myc-DDK-tagged)-Human SLAM family member 9 (SLAMF9), transcript variant 1 |
CNY 2,400.00 |
|
RC210366L3 | Lenti ORF clone of Human SLAM family member 9 (SLAMF9), transcript variant 1, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC210366L4 | Lenti ORF clone of Human SLAM family member 9 (SLAMF9), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RG210366 | SLAMF9 (tGFP-tagged) - Human SLAM family member 9 (SLAMF9), transcript variant 1 |
CNY 4,000.00 |