EPT1 (SELENOI) (NM_033505) Human Untagged Clone

CAT#: SC305647

EPT1 (untagged)-Human ethanolaminephosphotransferase 1 (CDP-ethanolamine-specific) (EPT1) (10ug), (Note: selenocysteine protein, Internal stop codon present. see reference data summary below)



  "NM_033505" in other vectors (3)

CNY 6,460.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Synonyms EPT1; SELI; SEPI; SPG81
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC305647 representing NM_033505.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGGCTGGCTACGAATACGTGAGCCCGGAGCAGCTGGCTGGCTTTGATAAGTACAAGTACAGTGCTGTG
GATACCAATCCACTTTCTCTGTATGTCATGCATCCATTCTGGAACACTATAGTAAAGGTATTTCCTACT
TGGCTGGCGCCCAATCTGATAACTTTTTCTGGCTTTCTGCTGGTCGTATTCAATTTTCTGCTAATGGCA
TACTTTGATCCTGACTTTTATGCCTCAGCACCAGGTCACAAGCACGTGCCTGACTGGGTTTGGATTGTA
GTGGGCATCCTCAACTTCGTAGCCTACACTCTAGATGGTGTGGACGGAAAGCAAGCTCGCAGAACCAAT
TCTAGCACTCCCTTAGGGGAGCTTTTTGATCATGGCCTGGATAGTTGGTCATGTGTTTACTTTGTTGTG
ACTGTTTATTCCATCTTTGGAAGAGGATCAACTGGTGTCAGTGTTTTTGTTCTTTATCTCCTGCTATGG
GTAGTTTTGTTTTCTTTCATCCTGTCCCACTGGGAAAAGTATAACACAGGGATTCTTTTCCTGCCATGG
GGATATGACATTAGCCAGGTGACTATTTCTTTTGTCTACATAGTGACTGCAGTTGTGGGAGTTGAGGCC
TGGTATGAACCTTTCCTGTTTAATTTCTTATATAGAGACCTATTCACTGCAATGATTATTGGTTGTGCA
TTATGTGTGACTCTTCCAATGAGTTTATTAAACTTTTTCAGAAGCTATAAAAATAACACCTTGAAACTC
AATTCAGTCTATGAAGCTATGGTTCCCTTATTTTCTCCATGCTTGCTGTTCATTTTGTCTACAGCGTGG
ATCCTTTGGTCACCTTCAGATATTTTAGAGCTACATCCTAGAGTATTCTACTTTATGGTTGGAACAGCT
TTTGCCAACAGTACATGTCAGCTGATTGTTTGCCAAATGAGTAGTACCCGGTGTCCAACTTTGAATTGG
TTGCTGGTTCCTCTCTTCTTGGTTGTCTTAGTGGTAAACCTAGGAGTAGCCTCTTACGTTGAGAGCATT
CTCCTGTATACATTAACAACTGCTTTTACTCTGGCCCACATCCATTATGGAGTACGAGTGGTAAAGCAG
CTGAGCAGCCATTTTCAGATTTACCCCTTCTCATTGAGGAAACCAAACTCAGATTGACTAGGAATGGAA
GAAAAGAATATTGGCCTGTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_033505
Insert Size 1194 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).

The expression of this clone is not guaranteed due to the nature of selenoproteins.
OTI Annotation This clone encodes a selenoprotein containing the rare amino acid selenocysteine (Sec). Sec is encoded by UGA codon, which normally signals translational termination. Expression of this clone is not guaranteed due to the nature of selenoproteins.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_033505.3
RefSeq Size 8143 bp
RefSeq ORF 1194 bp
Locus ID 85465
UniProt ID Q9C0D9
MW 45.2 kDa
Gene Summary The multi-pass transmembrane protein encoded by this gene belongs to the CDP-alcohol phosphatidyltransferase class-I family. It catalyzes the transfer of phosphoethanolamine from CDP-ethanolamine to diacylglycerol to produce phosphatidylethanolamine, which is involved in the formation and maintenance of vesicular membranes, regulation of lipid metabolism, and protein folding. This protein is a selenoprotein, containing the rare selenocysteine (Sec) amino acid at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon rather than as a stop signal. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2016]
Transcript Variant: This variant (1) represents the selenoprotein-encoding transcript. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...