p18 INK4c (CDKN2C) (NM_078626) Human Untagged Clone
CAT#: SC305779
CDKN2C (untagged)-Human cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4) (CDKN2C), transcript variant 2
CNY 3,990.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | INK4C; p18; p18-INK4C |
Vector | pCMV6-Entry |
E. coli Selection | Kanamycin (25 ug/mL) |
Mammalian Cell Selection | Neomycin |
Sequence Data |
>SC305779 representing NM_078626.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCCGAGCCTTGGGGGAACGAGTTGGCGTCCGCAGCTGCCAGGGGGGACCTAGAGCAACTTACTAGT TTGTTGCAAAATAATGTAAACGTCAATGCACAAAATGGATTTGGAAGGACTGCGCTGCAGGTTATGAAA CTTGGAAATCCCGAGATTGCCAGGAGACTGCTACTTAGAGGTGCTAATCCCGATTTGAAAGACCGAACT GGTTTCGCTGTCATTCATGATGCGGCCAGAGCAGGTTTCCTGGACACTTTACAGACTTTGCTGGAGTTT CAAGCTGATGTTAACATCGAGGATAATGAAGGGAACCTGCCCTTGCACTTGGCTGCCAAAGAAGGCCAC CTCCGGGTGGTGGAGTTCCTGGTGAAGCACACGGCCAGCAATGTGGGGCATCGGAACCATAAGGGGGAC ACCGCCTGTGATTTGGCCAGGCTCTATGGGAGGAATGAGGTTGTTAGCCTGATGCAGGCAAACGGGGCT GGGGGAGCCACAAATCTTCAATAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
Restriction Sites | SgfI-MluI |
ACCN | NM_078626 |
Insert Size | 507 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_078626.2 |
RefSeq Size | 1273 bp |
RefSeq ORF | 507 bp |
Locus ID | 1031 |
UniProt ID | P42773 |
Protein Families | Druggable Genome |
Protein Pathways | Cell cycle |
MW | 18.1 kDa |
Gene Summary | The protein encoded by this gene is a member of the INK4 family of cyclin-dependent kinase inhibitors. This protein has been shown to interact with CDK4 or CDK6, and prevent the activation of the CDK kinases, thus function as a cell growth regulator that controls cell cycle G1 progression. Ectopic expression of this gene was shown to suppress the growth of human cells in a manner that appears to correlate with the presence of a wild-type RB1 function. Studies in the knockout mice suggested the roles of this gene in regulating spermatogenesis, as well as in suppressing tumorigenesis. Two alternatively spliced transcript variants of this gene, which encode an identical protein, have been reported. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (2) contains a different 5' UTR region, and encodes an identical protein, when compared to variant 1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC214412 | CDKN2C (Myc-DDK-tagged)-Human cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4) (CDKN2C), transcript variant 2 |
CNY 2,400.00 |
|
RC214412L3 | Lenti ORF clone of Human cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4) (CDKN2C), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC214412L4 | Lenti ORF clone of Human cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4) (CDKN2C), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG214412 | CDKN2C (tGFP-tagged) - Human cyclin-dependent kinase inhibitor 2C (p18, inhibits CDK4) (CDKN2C), transcript variant 2 |
CNY 4,370.00 |
其它p18 INK4c产品