United States
Germany
Japan
United Kingdom
China
CLEC4C (NM_130441) Human Untagged Clone
CAT＃: SC305887
CLEC4C (untagged)-Human C-type lectin domain family 4, member C (CLEC4C), transcript variant 1
CNY 2,400.00
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | BDCA-2; BDCA2; CD303; CLECSF7; CLECSF11; DLEC; HECL; PRO34150 |
| Vector | pCMV6-XL5 |
| E. coli Selection | Ampicillin (100 ug/mL) |
| Mammalian Cell Selection | None |
| Sequence Data |
>OriGene sequence for NM_130441 edited
ATGGTGCCTGAAGAAGAGCCTCAAGACCGAGAGAAAGGACTCTGGTGGTTCCAGTTGAAG GTCTGGTCCATGGCAGTCGTATCCATCTTGCTCCTCAGTGTCTGTTTCACTGTGAGTTCT GTGGTGCCTCACAATTTTATGTATAGCAAAACTGTCAAGAGGCTGTCCAAGTTACGAGAG TATCAACAGTATCATCCAAGCCTGACCTGCGTCATGGAAGGAAAGGACATAGAAGATTGG AGCTGCTGCCCAACCCCTTGGACTTCATTTCAGTCTAGTTGCTACTTTATTTCTACTGGG ATGCAATCTTGGACTAAGAGTCAAAAGAACTGTTCTGTGATGGGGGCTGATCTGGTGGTG ATCAACACCAGGGAAGAACAGGATTTCATCATTCAGAATCTGAAAAGAAATTCTTCTTAT TTTCTGGGGCTGTCAGATCCAGGGGGTCGGCGACATTGGCAATGGGTTGACCAGACACCA TACAATGAAAATGTCACATTCTGGCACTCAGGTGAACCCAATAACCTTGATGAGCGTTGT GCGATAATAAATTTCCGTTCTTCAGAAGAATGGGGCTGGAATGACATTCACTGTCATGTA CCTCAGAAGTCAATTTGCAAGATGAAGAAGATCTACATATAA |
| Restriction Sites | Please inquire |
| ACCN | NM_130441 |
| Insert Size | 600 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_130441.2, NP_569708.1 |
| RefSeq Size | 1314 bp |
| RefSeq ORF | 642 bp |
| Locus ID | 170482 |
| UniProt ID | Q8WTT0 |
| Protein Families | Druggable Genome, Transmembrane |
| Gene Summary | This gene encodes a member of the C-type lectin/C-type lectin-like domain (CTL/CTLD) superfamily. Members of this family share a common protein fold and have diverse functions, such as cell adhesion, cell-cell signalling, glycoprotein turnover, and roles in inflammation and immune response. The encoded type 2 transmembrane protein may play a role in dendritic cell function. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (1) represents the longer transcript, and encodes the longer isoform (1). |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC217167 | CLEC4C (Myc-DDK-tagged)-Human C-type lectin domain family 4, member C (CLEC4C), transcript variant 1 |
CNY 2,400.00 |
|
| RC217167L1 | Lenti ORF clone of Human C-type lectin domain family 4, member C (CLEC4C), transcript variant 1, Myc-DDK-tagged |
CNY 4,800.00 |
|
| RC217167L2 | Lenti ORF clone of Human C-type lectin domain family 4, member C (CLEC4C), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
| RC217167L3 | Lenti ORF clone of Human C-type lectin domain family 4, member C (CLEC4C), transcript variant 1, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC217167L4 | Lenti ORF clone of Human C-type lectin domain family 4, member C (CLEC4C), transcript variant 1, mGFP tagged |
CNY 4,800.00 |
|
| RG217167 | CLEC4C (tGFP-tagged) - Human C-type lectin domain family 4, member C (CLEC4C), transcript variant 1 |
CNY 4,000.00 |
