Bim (BCL2L11) (NM_138621) Human Untagged Clone
CAT#: SC306048
BCL2L11 (untagged)-Human BCL2-like 11 (apoptosis facilitator) (BCL2L11), transcript variant 1
CNY 2,400.00
CNY 3,990.00
Cited in 3 publications. |
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
CNY 1,999.00
CNY 2,700.00
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BAM; BIM; BOD |
Vector | pCMV6-XL4 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene sequence for NM_138621 edited
CAAATGGCAAAGCAACCTTCTGATGTAAGTTCTGAGTGTGACCGAGAAGGTAGACAATTG CAGCCTGCGGAGAGGCCTCCCCAGCTCAGACCTGGGGCCCCTACCTCCCTACAGACAGAG CCACAAGGTAATCCTGAAGGCAATCACGGAGGTGAAGGGGACAGCTGCCCCCACGGCAGC CCTCAGGGCCCGCTGGCCCCACCTGCCAGCCCTGGCCCTTTTGCTACCAGATCCCCGCTT TTCATCTTTATGAGAAGATCCTCCCTGCTGTCTCGATCCTCCAGTGGGTATTTCTCTTTT GACACAGACAGGAGCCCAGCACCCATGAGTTGTGACAAATCAACACAAACCCCAAGTCCT CCTTGCCAGGCCTTCAACCACTATCTCAGTGCAATGGCTTCCATGAGGCAGGCTGAACCT GCAGATATGCGCCCAGAGATATGGATCGCCCAAGAATTGCGGCGTATTGGAGACGAGTTT AACGCTTACTATGCAAGGAGGGTATTTTTGAATAATTACCAAGCAGCCGAAGACCACCCA CGAATGGTTATCTTACGACTGTTACGTTACATTGTCCGCCTGGTGTGGAGAATGCATTGA C >OriGene 5' read for NM_138621 unedited
NNTTTGTNAAGTTAGATATTTGTATACGATCATATAGGCGGCCGCGNATTCCAAAGGCAA AGCACCTTCTGATGTAAGTTCTGAGTGTGACCGAGAAGGTAGACAATTGCAGCCTGCGGA GAGGCCTCCCCAGCTCAGACCTGGGGCCCCTACCTCCCTACAGACAGAGCCACAAGGTAA TCCTGAAGGCAATCACGGAGGTGAAGGGGACAGCTGCCCCCACGGCAGCCCTCAGGGCCC GCTGGCCCCACCTGCCAGCCCTGGCCCTTTTGCTACCAGATCCCCGCTTTTCATCTTTAT GAGAAGATCCTCCCTGCTGTCTCGATCCTCCAGTGGGTATTTCTCTTTTGACACAGACAG GAGCCCAGCACCCATGAGTTGTGACAAATCAACACAAACCCCAAGTCCTCCTTGCCAGGC CTTCAACCACTATCTCAGTGCAATGGCTTCCATGAGGCAGGCTGAACCTGCAGATATGCG CCCAGAGATATGGATCGCCCAAGAATTGCGGCGTATTGGAGACGAGTTTAACGCTTACTA TGCAAGGAGGGTATTTTTGAATAATTACCAAGCAGCCGAAGACCACCCACGAATGGTTAT CTTACGACTGTTACGTTACATTGTCCGCCTGGTGTGGAGAATGCATTGACTCGACTCTAG ATTGCGGCCGCGGTCATAGCTGTTTCCTGAACAGATCCCGGGTGGCATCCCTGTGACCCC TCCCCAGTGCCTCTCCTGGCCCTGGNAAGTGCCACTCCAGTGCCCACCAGCCTTGTCCTA ATAAATTAAGTTGCATCATTTTGTCTGACTAGGTGTCCTTCTATATATTATGGNGTGGAG GGGGTGGGTATGGAGCAGGGGCAAGTTGGG |
Restriction Sites | Please inquire |
ACCN | NM_138621 |
Insert Size | 600 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_138621.2, NP_619527.1 |
RefSeq Size | 3422 bp |
RefSeq ORF | 597 bp |
Locus ID | 10018 |
UniProt ID | O43521 |
Protein Families | Druggable Genome |
Gene Summary | The protein encoded by this gene belongs to the BCL-2 protein family. BCL-2 family members form hetero- or homodimers and act as anti- or pro-apoptotic regulators that are involved in a wide variety of cellular activities. The protein encoded by this gene contains a Bcl-2 homology domain 3 (BH3). It has been shown to interact with other members of the BCL-2 protein family and to act as an apoptotic activator. The expression of this gene can be induced by nerve growth factor (NGF), as well as by the forkhead transcription factor FKHR-L1, which suggests a role of this gene in neuronal and lymphocyte apoptosis. Transgenic studies of the mouse counterpart suggested that this gene functions as an essential initiator of apoptosis in thymocyte-negative selection. Several alternatively spliced transcript variants of this gene have been identified. [provided by RefSeq, Jun 2013] Transcript Variant: This variant (1, also known as BimEL) encodes the longest isoform (1). Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Citations (3)
The use of this cDNA Clones has been cited in the following citations: |
---|
Suppression of PP2A is critical for protection of melanoma cells upon endoplasmic reticulum stress
,null,
Cell Death & Disease
,PubMed ID 22739989
[BCL2L11]
|
Suppression of PP2A is critical for protection of melanoma cells upon endoplasmic reticulum stress
,K H Tay, L Jin, H-Y Tseng, C C Jiang, Y Ye, R F Thorne, T Liu, S T Guo, N M Verrills, P Hersey & X D Zhang,
Cell Death and Disease 3, e337 doi:10.1038/cddis.2012.79
[BCL2L11]
|
Activation of the JNK pathway promotes phosphorylation and degradation of BimEL—a novel mechanism of chemoresistance in T-cell acute lymphoblastic leukemia
,Kam Tong Leung, Karen Kwai-Har Li, Samuel Sai-Ming Sun, Paul Kay Sheung Chan, Vincent Eng-Choon Ooi, and Lawrence Chi-Ming Chiu,
Carcinogenesis, Mar 2008; 29: 544 - 551.
[BCL2L11]
|
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC207559 | BCL2L11 (Myc-DDK-tagged)-Human BCL2-like 11 (apoptosis facilitator) (BCL2L11), transcript variant 1 |
CNY 2,400.00 |
|
RC207559L1 | Lenti ORF clone of Human BCL2-like 11 (apoptosis facilitator) (BCL2L11), transcript variant 1, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC207559L2 | Lenti ORF clone of Human BCL2-like 11 (apoptosis facilitator) (BCL2L11), transcript variant 1, mGFP tagged |
CNY 5,890.00 |
|
RC207559L3 | Lenti ORF clone of Human BCL2-like 11 (apoptosis facilitator) (BCL2L11), transcript variant 1, Myc-DDK-tagged |
CNY 4,800.00 |
|
RC207559L4 | Lenti ORF clone of Human BCL2-like 11 (apoptosis facilitator) (BCL2L11), transcript variant 1, mGFP tagged |
CNY 4,800.00 |
|
RG207559 | BCL2L11 (tGFP-tagged) - Human BCL2-like 11 (apoptosis facilitator) (BCL2L11), transcript variant 1 |
CNY 4,000.00 |