United States
Germany
Japan
United Kingdom
China
Claudin 14 (CLDN14) (NM_144492) Human Untagged Clone
CAT＃: SC306147
CLDN14 (untagged)-Human claudin 14 (CLDN14), transcript variant 1
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | DFNB29 |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC306147 representing NM_144492.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCCAGCACGGCCGTGCAGCTTCTGGGCTTCCTGCTCAGCTTCCTGGGCATGGTGGGCACGTTGATC ACCACCATCCTGCCGCACTGGCGGAGGACAGCGCACGTGGGCACCAACATCCTCACGGCCGTGTCCTAC CTGAAAGGGCTCTGGATGGAGTGTGTGTGGCACAGCACAGGCATCTACCAGTGCCAGATCTACCGATCC CTGCTGGCGCTGCCCCAAGACCTCCAGGCTGCCCGCGCCCTCATGGTCATCTCCTGCCTGCTCTCGGGC ATAGCCTGCGCCTGCGCCGTCATCGGGATGAAGTGCACGCGCTGCGCCAAGGGCACACCCGCCAAGACC ACCTTTGCCATCCTCGGCGGCACCCTCTTCATCCTGGCCGGCCTCCTGTGCATGGTGGCCGTCTCCTGG ACCACCAACGACGTGGTGCAGAACTTCTACAACCCGCTGCTGCCCAGCGGCATGAAGTTTGAGATTGGC CAGGCCCTGTACCTGGGCTTCATCTCCTCGTCCCTCTCGCTCATTGGTGGCACCCTGCTTTGCCTGTCC TGCCAGGACGAGGCACCCTACAGGCCCTACCAGGCCCCGCCCAGGGCCACCACGACCACTGCAAACACC GCACCTGCCTACCAGCCACCAGCTGCCTACAAAGACAATCGGGCCCCCTCAGTGACCTCGGCCACGCAC AGCGGGTACAGGCTGAACGACTACGTGTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_144492 |
| Insert Size | 720 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_144492.2 |
| RefSeq Size | 1958 bp |
| RefSeq ORF | 720 bp |
| Locus ID | 23562 |
| UniProt ID | O95500 |
| Protein Families | Druggable Genome, Transmembrane |
| Protein Pathways | Cell adhesion molecules (CAMs), Leukocyte transendothelial migration, Tight junction |
| MW | 25.7 kDa |
| Gene Summary | Tight junctions represent one mode of cell-to-cell adhesion in epithelial or endothelial cell sheets, forming continuous seals around cells and serving as a physical barrier to prevent solutes and water from passing freely through the paracellular space. These junctions are comprised of sets of continuous networking strands in the outwardly facing cytoplasmic leaflet, with complementary grooves in the inwardly facing extracytoplasmic leaflet. The protein encoded by this gene, a member of the claudin family, is an integral membrane protein and a component of tight junction strands. The encoded protein also binds specifically to the WW domain of Yes-associated protein. Defects in this gene are the cause of an autosomal recessive form of nonsyndromic sensorineural deafness. It is also reported that four synonymous variants in this gene are associated with kidney stones and reduced bone mineral density. Several transcript variants encoding the same protein have been found for this gene. [provided by RefSeq, Jun 2010] Transcript Variant: This variant (alpha) represents the longest transcript. All five variants encode the same protein. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC219687 | CLDN14 (Myc-DDK-tagged)-Human claudin 14 (CLDN14), transcript variant 1 |
CNY 2,400.00 |
|
| RC219687L3 | Lenti-ORF clone of CLDN14 (Myc-DDK-tagged)-Human claudin 14 (CLDN14), transcript variant 1 |
CNY 4,800.00 |
|
| RC219687L4 | Lenti-ORF clone of CLDN14 (mGFP-tagged)-Human claudin 14 (CLDN14), transcript variant 1 |
CNY 4,800.00 |
|
| RG219687 | CLDN14 (tGFP-tagged) - Human claudin 14 (CLDN14), transcript variant 1 |
CNY 4,370.00 |
其它Claudin 14产品
