PFDN5 (NM_145897) Human Untagged Clone
CAT#: SC306290
PFDN5 (untagged)-Human prefoldin subunit 5 (PFDN5), transcript variant 3
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | MM-1; MM1; PFD5 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_145897, the custom clone sequence may differ by one or more nucleotides
ATGGCGCAGTCTATTAACATCACGGAGCTGAATCTGCCGCAGCTAGAAATGCTCAAGAAC CAGCTGGACCAGATGTATGTCCCTGGGAAGCTGCATGATGTGGAACACGTGCTCATCGAT GTGGGAACTGGGTACTATGTAGAGAAGACAGCTGAGGATGCCAAGGACTTCTTCAAGAGG AAGATAGATTTTCTAACCAAGCAGATGGAGAAAATCCAACCAGCTCTTCAGGAGAAGCAC GCCATGAAACAGGCCGTCATGGAAATGATGAGTCAGAAGATTCAGCAGCTCACAGCCCTG GGGGCAGCTCAGGCTACTGCTAAGGCCTGA |
Restriction Sites | Please inquire |
ACCN | NM_145897 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_145897.1, NP_665904.1 |
RefSeq Size | 526 bp |
RefSeq ORF | 330 bp |
Locus ID | 5204 |
UniProt ID | Q99471 |
Protein Families | Transcription Factors |
Gene Summary | This gene encodes a member of the prefoldin alpha subunit family. The encoded protein is one of six subunits of prefoldin, a molecular chaperone complex that binds and stabilizes newly synthesized polypeptides, thereby allowing them to fold correctly. The complex, consisting of two alpha and four beta subunits, forms a double beta barrel assembly with six protruding coiled-coils. The encoded protein may also repress the transcriptional activity of the proto-oncogene c-Myc. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (3) lacks two exons in the coding region but maintains the reading frame, compared to variant 1. The encoded protein (isoform gamma) is shorter than isoform alpha. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC223996 | PFDN5 (Myc-DDK-tagged)-Human prefoldin subunit 5 (PFDN5), transcript variant 3 |
CNY 3,990.00 |
|
RC223996L3 | Lenti-ORF clone of PFDN5 (Myc-DDK-tagged)-Human prefoldin subunit 5 (PFDN5), transcript variant 3 |
CNY 5,890.00 |
|
RC223996L4 | Lenti-ORF clone of PFDN5 (mGFP-tagged)-Human prefoldin subunit 5 (PFDN5), transcript variant 3 |
CNY 5,890.00 |
|
RG223996 | PFDN5 (tGFP-tagged) - Human prefoldin subunit 5 (PFDN5), transcript variant 3 |
CNY 4,370.00 |