WFDC10B (NM_172131) Human Untagged Clone

CAT#: SC306724

WFDC10B (untagged)-Human WAP four-disulfide core domain 10B (WFDC10B), transcript variant 2



  "NM_172131" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (3)
TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms WAP12
Vector pCMV6 series
Sequence Data
>NCBI ORF sequence for NM_172131, the custom clone sequence may differ by one or more nucleotides
ATGGTGTCTTGTGAAAGGAGGGCAAGCAAAAGTGTAGGACAAATTTTGCTTTGGGATTTT
GGTTACACCTGCAGACTATCCCACAGAAGGAGGAACAGCACTGAAATCCTTTCTCGCAAT
CTTCCTGCATTGTACACAGGAATCAAGGTCTGTGAGAAGCGACCCAGCATAGATCTATGC
ATCCACCACTGTTCATATTTCCAAAAGTGTGAAACAAATAAGATATGCTGTTCAGCCTTC
TGTGGGAACATTTGTATGAGCATCCTATGA
Restriction Sites Please inquire     
ACCN NM_172131
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Reference Data
RefSeq NM_172131.2, NP_742143.1
RefSeq Size 477 bp
RefSeq ORF 270 bp
Locus ID 280664
UniProt ID Q8IUB3
Protein Families Secreted Protein, Transmembrane
Gene Summary This gene encodes a member of the WAP-type four-disulfide core (WFDC) domain family. The WFDC domain, or WAP signature motif, contains eight cysteines forming four disulfide bonds at the core of the protein, and functions as a protease inhibitor. Most WFDC gene members are localized to chromosome 20q12-q13 in two clusters: centromeric and telomeric. This gene belongs to the telomeric cluster. Two alternatively spliced transcript variants have been found for this gene, and they encode distinct isoforms. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (2) lacks an internal exon and uses an upstream translation start codon, as compared to variant 1. It encodes the longer isoform (b), which lacks a signal peptide and may be an intracellular protein.
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...