TAS2R46 (NM_176887) Human Untagged Clone
CAT#: SC307081
TAS2R46 (untagged)-Human taste receptor, type 2, member 46 (TAS2R46)
CNY 2,400.00
CNY 6,270.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | T2R46; T2R54 |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_176887 edited
ATGATAACTTTTCTGCCCATCATTTTTTCCATTCTAATAGTGGTTACATTTGTGATTGGA AATTTTGCTAATGGCTTCATAGCATTGGTAAATTCCATTGAGTGGTTCAAGAGACAAAAG ATCTCTTTTGCTGACCAAATTCTCACTGCTCTGGCAGTCTCCAGAGTTGGTTTACTCTGG GTATTAGTATTAAATTGGTATGCAACTGAGTTGAATCCAGCTTTTAACAGTATAGAAGTA AGAATTACTGCTTACAATGTCTGGGCAGTAATCAACCATTTCAGCAACTGGCTTGCTACT AGCCTCAGCATATTTTATTTGCTCAAGATTGCCAATTTCTCCAACCTTATTTTTCTTCAC TTAAAGAGGAGAGTTAAGAGTGTTGTTCTGGTGATACTATTGGGGCCTTTGCTATTTTTG GTTTGTCATCTTTTTGTGATAAACATGAATCAGATTATATGGACAAAAGAATATGAAGGA AACATGACTTGGAAGATCAAACTGAGGAGTGCAATGTACCTTTCAAATACAACGGTAACC ATCCTAGCAAACTTAGTTCCCTTCACTCTGACCCTGATATCTTTTCTGCTGTTAATCTGT TCTCTGTGTAAACATCTCAAAAAGATGCAGCTCCATGGCAAAGGATCTCAAGATCCCAGC ATGAAGGTCCACATAAAAGCTATGCAAACTGTGACCTCCTTCCTCTTGTTATGTGCCATT TACTTTCTGTCCATAATCATGTCAGTTTGGAGTTTTGAGAGTCTGGAAAACAAACCTGTC TTCATGTTCTGCGAAGCTATTGCATTCAGCTATCCTTCAACCCACCCATTCATCCTGATT TGGGGAAACAAGAAGCTAAAGCAGACTTTTCTTTCAGTTTTGTGGCATGTGAGGTACTGG GTGAAAGGAGAGAAGCCTTCATCTTCATAG |
Restriction Sites | Please inquire |
ACCN | NM_176887 |
Insert Size | 900 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
Reference Data | |
RefSeq | NM_176887.1, NP_795368.1 |
RefSeq Size | 900 bp |
RefSeq ORF | 900 bp |
Locus ID | 259292 |
UniProt ID | P59540 |
Protein Pathways | Taste transduction |
Gene Summary | TAS2R46 belongs to the large TAS2R receptor family. TAS2Rs are expressed on the surface of taste receptor cells and mediate the perception of bitterness through a G protein-coupled second messenger pathway (Conte et al., 2002 [PubMed 12584440]). For further information on TAS2Rs, see MIM 604791.[supplied by OMIM, Sep 2009] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC220115 | TAS2R46 (Myc-DDK-tagged)-Human taste receptor, type 2, member 46 (TAS2R46) |
CNY 2,400.00 |
|
RC220115L3 | Lenti ORF clone of Human taste receptor, type 2, member 46 (TAS2R46), Myc-DDK-tagged |
CNY 5,890.00 |
|
RC220115L4 | Lenti ORF clone of Human taste receptor, type 2, member 46 (TAS2R46), mGFP tagged |
CNY 5,890.00 |
|
RG220115 | TAS2R46 (tGFP-tagged) - Human taste receptor, type 2, member 46 (TAS2R46) |
CNY 4,370.00 |
|
SC317464 | TAS2R46 (untagged)-Human taste receptor, type 2, member 46 (TAS2R46) |
CNY 2,400.00 |
其它TAS2R46产品