United States
Germany
Japan
United Kingdom
China
Inosine triphosphate pyrophosphatase (ITPA) (NM_181493) Human Untagged Clone
CAT＃: SC307286
ITPA (untagged)-Human inosine triphosphatase (nucleoside triphosphate pyrophosphatase) (ITPA), transcript variant 2
CNY 3,990.00
Product images
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | C20orf37; DEE35; dJ794I6.3; HLC14-06-P; ITPase; My049; NTPase |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC307286 representing NM_181493.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGGCGGCCTCATTGGTCGTTCAGATTCTAGGAGATAAGTTTCCATGCACTTTGGTGGCACAGAAAATT GACCTGCCGGAGTACCAGGGGGAGCCGGATGAGATTTCCATACAGAAATGTCAGGAGGCAGTTCGCCAG GTACAGGGGCCCGTGCTGGTTGAGGACACTTGTCTGTGCTTCAATGCCCTTGGAGGGCTCCCCGGCCCC TACATAAAGTGGTTTCTGGAGAAGTTAAAGCCTGAAGGTCTCCACCAGCTCCTGGCCGGGTTCGAGGAC AAGTCAGCCTATGCGCTCTGCACGTTTGCACTCAGCACCGGGGACCCAAGCCAGCCCGTGCGCCTGTTC AGGGGCCGGACCTCGGGCCGGATCGTGGCACCCAGAGGCTGCCAGGACTTTGGCTGGGACCCCTGCTTT CAGCCTGATGGATATGAGCAGACGTACGCAGAGATGCCTAAGGCGGAGAAGAACGCTGTCTCCCATCGC TTCCGGGCCCTGCTGGAGCTGCAGGAGTACTTTGGCAGTTTGGCAGCTTGA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_181493 |
| Insert Size | 534 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_181493.3 |
| RefSeq Size | 1151 bp |
| RefSeq ORF | 534 bp |
| Locus ID | 3704 |
| UniProt ID | Q9BY32 |
| Protein Families | Druggable Genome |
| Protein Pathways | Drug metabolism - other enzymes, Metabolic pathways, Purine metabolism, Pyrimidine metabolism |
| MW | 19.6 kDa |
| Gene Summary | This gene encodes an inosine triphosphate pyrophosphohydrolase. The encoded protein hydrolyzes inosine triphosphate and deoxyinosine triphosphate to the monophosphate nucleotide and diphosphate. This protein, which is a member of the HAM1 NTPase protein family, is found in the cytoplasm and acts as a homodimer. Defects in the encoded protein can result in inosine triphosphate pyrophosphorylase deficiency which causes an accumulation of ITP in red blood cells. Alternate splicing results in multiple transcript variants. [provided by RefSeq, Jun 2012] Transcript Variant: This variant (2) uses an alternate in-frame splice site in the 5' coding region compared to variant 1, resulting in a shorter protein (isoform b) compared to isoform a. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC215516 | ITPA (Myc-DDK-tagged)-Human inosine triphosphatase (nucleoside triphosphate pyrophosphatase) (ITPA), transcript variant 2 |
CNY 2,400.00 |
|
| RC215516L3 | Lenti ORF clone of Human inosine triphosphatase (nucleoside triphosphate pyrophosphatase) (ITPA), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC215516L4 | Lenti ORF clone of Human inosine triphosphatase (nucleoside triphosphate pyrophosphatase) (ITPA), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
| RG215516 | ITPA (tGFP-tagged) - Human inosine triphosphatase (nucleoside triphosphate pyrophosphatase) (ITPA), transcript variant 2 |
CNY 4,370.00 |
其它Inosine triphosphate pyrophosphatase产品
