HTR3D (NM_182537) Human Untagged Clone
CAT#: SC307429
HTR3D (untagged)-Human 5-hydroxytryptamine (serotonin) receptor 3 family member D (HTR3D), transcript variant 2
CNY 2,400.00
CNY 6,270.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | 5HT3D |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_182537 edited
GCCCTTCACCTGAACAAGGAGAGGGTGGTGGCATGGGACCTGCCTTCCTGGAGTTAATCA TCTAGATGAAAGCTGCTATTCCAGGATTCACACCTTCAACTGGTGACATCGTTCCTGTGG CTAAATATGCATCAGTGTGGATCAGACACCTGCAGGTCTCATGGCTAGTATGTCAATAGT GAAGGCCACATCAAACACAATAAGCCAATGTGGGTGGCCAGCATCTGCAAACTGGACACC TTCTATTTCCCCTTCCATGGACAGAGGTGAACGCTCTCCTTCAGCCCTTTCACCTACACA GGTGGCCATCAGGCGCAGGTGCAGGCCCAGCCCCTACGTGGTAAACTTTCTGGTGCCCAG TGGCATTCTGATTGCCATCGATGCCCTCAGTTTCTACCTGCCACTGGAAAGTGGGAATTG TGCCCCATTCAAGATGACTGTTCTGCTGGGCTACAGCGTCTTCCTGCTCATGATGAATGA CTTGCTCCCAGCCACTAGCACTTCATCACATGCTTCACTAGTACGTCCTCATCCATCAAG AGACCAAAAGCGAGGTGTCTACTTCGCCCTGTGCCTGTCCCTGATGGTGGGCAGCCTGCT GGAGACCATCTTCATCACCCACCTGCTGCACGTGGCCACCACCCAGCCCCTACCTCTGCC TCGGTGGCTCCACTCCCTGCTGCTGCACTGCACCGGCCAAGGGAGATGCTGTCCCACTGC GCCCCAGAAGGGAAATAAGGGCCCGGGTCTCACCCCCACCCACCTGCCCGGTGTGAAGGA GCCAGAGGTATCAGCAGGGCAGATGCCAGGCCCTGGGGAGGCAGAGCTGACAGGGGGCTC AGAATGGACAAGGGCCCAGCGGGAACACGAGGCCCAGAAGCAGCACTCGGTGGAGCTGTG GGTGCAGTTCAGCCACGCGATGGACGCCCTGCTCTTCCACCTCTACCTGCTCTTCATGGC CTCCTCCATCATCACCGTTATATGCCTCTGGAACACCTAGGCAGGTGCTCACCTGCCAAC TTCAGTCTGGACTTCTTTTTGCCAAAGAACTCCAGAAACCAGTCAGGCTCTCATGTCAGT CCAAATTTCAGCCTTGTGGCCCTGTCAACCGCCTCATTTTTAACCCAGTCCTCTGTGTAG TTTCAGGCCAGACCTGAATAGTCTCCTATGCCCTCCAAAAGTCGGGTCCTTGCTCCTGCA TGCCATCAGCCCCACTCAGCCCTCCCATACCTCCCTGGGATTTAAAGGGC |
Restriction Sites | Please inquire |
ACCN | NM_182537 |
Insert Size | 1200 bp |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The ORF of this clone has been fully sequenced and found to contain 2 SNPs compared with NM_182537.2. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_182537.2, NP_872343.2 |
RefSeq Size | 1486 bp |
RefSeq ORF | 840 bp |
Locus ID | 200909 |
UniProt ID | Q70Z44 |
Protein Families | Druggable Genome, Ion Channels: Cys-loop Receptors, Transmembrane |
Gene Summary | The protein encoded this gene belongs to the ligand-gated ion channel receptor superfamily. This gene encodes subunit D of the type 3 receptor for 5-hydroxytryptamine (serotonin), a biogenic hormone that functions as a neurotransmitter, a mitogen and a hormone. This hormone has been linked to neuropsychiatric disorders, including anxiety, depression, and migraine. Serotonin receptors causes fast and depolarizing responses in neurons following activation. The genes encoding subunits C, D and E of this type 3 receptor form a cluster on chromosome 3. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jul 2009] Transcript Variant: This variant (2) differs in the presence and absence of exons at its 5' end, and uses a downstream translational start codon, compared to variant 3. The resulting isoform (2) is shorter at the N-terminus, compared to isoform 3. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC211826 | HTR3D (Myc-DDK-tagged)-Human 5-hydroxytryptamine (serotonin) receptor 3 family member D (HTR3D), transcript variant 2 |
CNY 2,400.00 |
|
RC211826L3 | Lenti ORF clone of Human 5-hydroxytryptamine (serotonin) receptor 3 family member D (HTR3D), transcript variant 2, Myc-DDK-tagged |
CNY 5,890.00 |
|
RC211826L4 | Lenti ORF clone of Human 5-hydroxytryptamine (serotonin) receptor 3 family member D (HTR3D), transcript variant 2, mGFP tagged |
CNY 5,890.00 |
|
RG211826 | HTR3D (tGFP-tagged) - Human 5-hydroxytryptamine (serotonin) receptor 3 family member D (HTR3D), transcript variant 2 |
CNY 4,000.00 |