United States
Germany
Japan
United Kingdom
China
CREM (NM_183011) Human Untagged Clone
CAT＃: SC307551
CREM (untagged)-Human cAMP responsive element modulator (CREM), transcript variant 21
CNY 6,270.00
Product images
CNY 1,999.00
CNY 2,700.00
Specifications
| Product Data | |
| Type | Human Untagged Clone |
| Tag | Tag Free |
| Synonyms | CREM-2; hCREM-2; ICER |
| Vector | pCMV6-Entry |
| E. coli Selection | Kanamycin (25 ug/mL) |
| Mammalian Cell Selection | Neomycin |
| Sequence Data |
>SC307551 representing NM_183011.
Blue=Insert sequence Red=Cloning site Green=Tag(s) GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC ATGAGCAAATGTGCAAGGAAAAAATATATTAAGACAAATCCAAGACAAATGACCATGGAAACAGTTGAA TCCCAGCATGATGGAAGTATAACAGCTTCTTTGACAGAGAGCAAGTCTGCTCATGTGCAGACTCAGACT GGCCAAAATTCAATCCCTGCTTTAGCTCAGGTAGCAGCAATTGCAGAGACAGATGAATCTGCAGAATCA GAAGGTGTAATTGATTCTCATAAACGTAGAGAAATCCTTTCACGAAGACCCTCTTATAGGAAAATACTG AATGAACTGTCCTCTGATGTGCCTGGTGTTCCCAAGATTGAAGAAGAGAGATCAGAGGAAGAAGGAACA CCACCTAGTATTGCTACCATGGCAGTACCAACTAGCATATATCAGACTAGCACGGGGCAATACATTGCT ATAGCCCAAGGTGGAACAATCCAGATTTCTAACCCAGGATCTGATGGTGTTCAGGGACTGCAGGCATTA ACAATGACAAATTCAGGAGCTCCTCCACCAGGTGCTACAATTGTACAGTACGCAGCACAATCAGCTGAT GGCACACAGCAGTTCTTTGTCCCAGGCAGCCAGGTTGTTGTTCAAGCTGCCACTGGTGACATGCCAACT TACCAGATCCGAGCTCCTACTGCTGCTTTGCCACAGGGAGTGGTGATGGCTGCATCGCCCGGAAGTTTG CACAGTCCCCAGCAGCTGGCAGAAGAAGCAACACGCAAACGAGAGCTGAGGCTAATGAAAAACAGGGAA GCTGCCCGGGAGTGTCGCAGGAAGAAGAAAGAATATGTCAAATGTCTTGAAAATCGTGTGGCTGTGCTT GAAAACCAAAACAAGACTCTCATTGAGGAACTCAAGGCCCTCAAAGATCTTTATTGCCATAAAGTAGAG TAA ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT TACAAGGATGACGACGATAAGGTTTAAACGGCCGGC |
| Restriction Sites | SgfI-MluI |
| ACCN | NM_183011 |
| Insert Size | 900 bp |
| OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
| OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
| Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
| Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
| Note | Plasmids are not sterile. For experiments where strict sterility is required, filtration with 0.22um filter is required. |
| Reference Data | |
| RefSeq | NM_183011.1 |
| RefSeq Size | 2519 bp |
| RefSeq ORF | 900 bp |
| Locus ID | 1390 |
| UniProt ID | Q03060 |
| Protein Families | Druggable Genome, Transcription Factors |
| MW | 32.5 kDa |
| Gene Summary | This gene encodes a bZIP transcription factor that binds to the cAMP responsive element found in many viral and cellular promoters. It is an important component of cAMP-mediated signal transduction during the spermatogenetic cycle, as well as other complex processes. Alternative promoter and translation initiation site usage allows this gene to exert spatial and temporal specificity to cAMP responsiveness. Multiple alternatively spliced transcript variants encoding several different isoforms have been found for this gene, with some of them functioning as activators and some as repressors of transcription. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (21), also known as CREM 10, differs in the 5' UTR, 3' UTR, and contains an additional segment in the coding region, compared to variant 1. This results in a shorter isoform (21, also known as u) with a distinct C-terminus, compared to isoform 1. This isoform represents the tau2 activator isoform. Sequence Note: This RefSeq record was created from transcript and genomic sequence data to make the sequence consistent with the reference genome assembly. The genomic coordinates used for the transcript record were based on transcript alignments. |
Documents
| Product Manuals |
| FAQs |
| SDS |
Resources
Other Versions
| SKU | Description | Size | Price |
|---|---|---|---|
| RC217095 | CREM (Myc-DDK-tagged)-Human cAMP responsive element modulator (CREM), transcript variant 21 |
CNY 2,400.00 |
|
| RC217095L3 | Lenti ORF clone of Human cAMP responsive element modulator (CREM), transcript variant 21, Myc-DDK-tagged |
CNY 5,890.00 |
|
| RC217095L4 | Lenti ORF clone of Human cAMP responsive element modulator (CREM), transcript variant 21, mGFP tagged |
CNY 5,890.00 |
|
| RG217095 | CREM (tGFP-tagged) - Human cAMP responsive element modulator (CREM), transcript variant 21 |
CNY 4,370.00 |
