Osteocrin (OSTN) (NM_198184) Human Untagged Clone
CAT#: SC307642
OSTN (untagged)-Human osteocrin (OSTN)
CNY 1,200.00
CNY 3,990.00
Product images
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | MUSCLIN |
Vector | pCMV6-XL5 |
E. coli Selection | Ampicillin (100 ug/mL) |
Mammalian Cell Selection | None |
Sequence Data |
>OriGene ORF sequence for NM_198184 edited
ATGCTGGACTGGAGATTGGCAAGTGCACATTTCATCCTGGCTGTGACACTGACACTGTGG AGCTCAGGAAAAGTCCTCTCAGTAGATGTAACAACAACAGAGGCCTTTGATTCTGGAGTC ATAGATGTGCAGTCAACACCCACAGTCAGGGAAGAGAAATCAGCCACTGACCTGACAGCA AAACTCTTGCTTCTTGATGAATTGGTGTCCCTAGAAAATGATGTGATTGAGACAAAGAAG AAAAGGAGTTTCTCTGGTTTTGGGTCTCCCCTTGACAGACTCTCAGCTGGCTCTGTAGAT CACAAAGGTAAACAGAGGAAAGTAGTAGATCATCCAAAAAGGCGATTTGGTATCCCCATG GATCGGATTGGTAGAAACCGGCTTTCAAATTCCAGAGGCTAA |
Restriction Sites | Please inquire |
ACCN | NM_198184 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | The open reading frame of this TrueClone was fully sequenced and found to be a perfect match to the protein associated to this reference. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_198184.1, NP_937827.1 |
RefSeq Size | 402 bp |
RefSeq ORF | 402 bp |
Locus ID | 344901 |
UniProt ID | P61366 |
Protein Families | ES Cell Differentiation/IPS, Secreted Protein |
Gene Summary | Hormone that acts as a regulator of dendritic growth in the developing cerebral cortex in response to sensory experience (PubMed:27830782). Induced in the brain following membrane depolarization and inhibits dendritic branching in neurons of the developing cortex (PubMed:27830782). Probably acts by binding to natriuretic peptide receptor NPR3/NPR-C, thereby preventing binding between NPR3/NPR-C and natriuretic peptides, leading to increase cGMP production (By similarity).[UniProtKB/Swiss-Prot Function] |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC219416 | OSTN (Myc-DDK-tagged)-Human osteocrin (OSTN) |
CNY 1,200.00 |
|
RC219416L1 | Lenti ORF clone of Human osteocrin (OSTN), Myc-DDK-tagged |
CNY 3,600.00 |
|
RC219416L2 | Lenti ORF clone of Human osteocrin (OSTN), mGFP tagged |
CNY 5,890.00 |
|
RC219416L3 | Lenti ORF clone of Human osteocrin (OSTN), Myc-DDK-tagged |
CNY 3,600.00 |
|
RC219416L4 | Lenti ORF clone of Human osteocrin (OSTN), mGFP tagged |
CNY 5,890.00 |
|
RG219416 | OSTN (tGFP-tagged) - Human osteocrin (OSTN) |
CNY 2,800.00 |
其它Osteocrin产品