THYN1 (NM_199298) Human Untagged Clone

CAT#: SC307928

THYN1 (untagged)-Human thymocyte nuclear protein 1 (THYN1), transcript variant 3



  "NM_199298" in other vectors (4)

CNY 3,990.00


货期*
4周

规格
    • 10 ug

Product images

经常一起买 (4)
Rabbit Polyclonal Anti-THYN1 Antibody
    • 100 ul

CNY 1,999.00
CNY 3,280.00


TurboFectin Transfection Reagent (1 mL in 1 vial)
    • 1 ml in 1 vial

CNY 4,090.00


DH5α Chemically Competent Cells (≥10^8 cfu/μg of pUC19 DNA)
    • 5 x 200 ul

CNY 1,280.00


Forward sequencing primer VP1.5, Reverse sequencing primer XL39, 100pmoles each
    • 100 pmol

CNY 480.00

Specifications

Product Data
Type Human Untagged Clone
Tag Tag Free
Synonyms HSPC144; MDS012; MY105; THY28; THY28KD
Vector pCMV6-Entry
E. coli Selection Kanamycin (25 ug/mL)
Mammalian Cell Selection Neomycin
Sequence Data
>SC307928 representing NM_199298.
Blue=Insert sequence Red=Cloning site Green=Tag(s)

GCTCGTTTAGTGAACCGTCAGAATTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTG
GATCCGGTACCGAGGAGATCTGCCGCCGCGATCGCC
ATGTCGAGACCCCGGAAGAGGCTGGCTGGGACTTCTGGTTCAGACAAGGGACTATCAGGAAAACGCACC
AAAACTGAGAACTCAGGTGAGGCATTAGCTAAAGTGGAGGACTCCAACCCTCAGAAGACTTCAGCCACT
AAAAACTGTTTGAAGAATCTAAGCAGCCACTGGCTGATGAAGTCAGAGCCAGAGAGCCGCCTAGAGAAA
GGTGTAGATGTGAAGTTCAGCATTGAGGATCTCAAAGCACAGCCCAAACAGACAACATGCTGGGATGGT
GTTCGTAACTACCAGGCTCGGAACTTCCTTAGAGCCATGAAGCTGGGAGAAGAAGCCTTCTTCTACCAT
AGCAACTGCAAAGAGCCAGGCATCGCAGGACTCATGAAGATCGTGAAAGAGGCTTACCCAGACCACACA
CAGTTTGAGAAAAACAATCCCCATTATGACCCATCTAGCAAAGAGGACAACCCTAAGTGGTCCATGGTG
GATGTACAGTTTGTTCGGATGATGAAACGTTTCATTCCCCTGGCTGAGCTCAAATCCTATCATCAAGCT
CACAAAGCTACTGGTGGCCCCTTAAAAAATATGGTTCTCTTCACTCGCCAGAGATTATCAATCCAGCCC
CTGACCCAGGAAGAGTTTGATTTTGTTTTGAGCCTGGAGGAAAAGGAACCAAGTTAA

ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGAT
TACAAGGATGACGACGATAAG
GTTTAAACGGCCGGC
Restriction Sites SgfI-MluI     
ACCN NM_199298
Insert Size 678 bp
OTI Disclaimer Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP).
OTI Annotation This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA.
Product Components The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water).
Reconstitution 1. Centrifuge at 5,000xg for 5min.
2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA.
3. Close the tube and incubate for 10 minutes at room temperature.
4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom.
5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C.
Note Plasmids are not sterile.  For experiments where strict sterility is required, filtration with 0.22um filter is required.
Reference Data
RefSeq NM_199298.1
RefSeq Size 1013 bp
RefSeq ORF 678 bp
Locus ID 29087
UniProt ID Q9P016
MW 25.7 kDa
Gene Summary This gene encodes a protein that is highly conserved among vertebrates and plant species and may be involved in the induction of apoptosis. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Transcript Variant: This variant (3) differs in the 5' UTR compared to variant 1. Variants 1, 3, and 5 encode the same isoform (1).
*Delivery time may vary from web posted schedule. Occasional delays may occur due to unforeseen complexities in the preparation of your product. International customers may expect an additional 1-2 weeks in shipping.

Other Versions

Customer Reviews 
Loading...