Myelin oligodendrocyte glycoprotein (MOG) (NM_206814) Human Untagged Clone
CAT#: SC308263
MOG (untagged)-Human myelin oligodendrocyte glycoprotein (MOG), transcript variant alpha5
CNY 3,990.00
Product images
![](https://cdn.origene.com/img/defaults-img.jpg)
Specifications
Product Data | |
Type | Human Untagged Clone |
Tag | Tag Free |
Synonyms | BTN6; BTNL11; MOGIG2; NRCLP7 |
Vector | pCMV6 series |
Sequence Data |
>NCBI ORF sequence for NM_206814, the custom clone sequence may differ by one or more nucleotides
ATGGCAAGCTTATCAAGACCCTCTCTGCCCAGCTGCCTCTGCTCCTTCCTCCTCCTCCTC CTCCTCCAAGTGTCTTCCAGCTATGCAGGGCAGTTCAGAGTGATAGGACCAAGACACCCT ATCCGGGCTCTGGTCGGGGATGAAGTGGAATTGCCATGTCGCATATCTCCTGGGAAGAAC GCTACAGGCATGGAGGTGGGGTGGTACCGCCCCCCCTTCTCTAGGGTGGTTCATCTCTAC AGAAATGGCAAGGACCAAGATGGAGACCAGGCACCTGAATATCGGGGCCGGACAGAGCTG CTGAAAGATGCTATTGGTGAGGGAAAGGTGACTCTCAGGATCCGGAATGTAAGGTTCTCA GATGAAGGAGGTTTCACCTGCTTCTTCCGAGATCATTCTTACCAAGAGGAGGCAGCAATG GAATTGAAAGTAGAAGTGTCTCACTCTGTCACCCAGGATTGGTTGCAGTGGCACGATCAT GGCTCATTGCAGCCTCCACCTCCCAGGCTCAAGTGA |
Restriction Sites | Please inquire |
ACCN | NM_206814 |
OTI Disclaimer | Our molecular clone sequence data has been matched to the reference identifier above as a point of reference. Note that the complete sequence of our molecular clones may differ from the sequence published for this corresponding reference, e.g., by representing an alternative RNA splicing form or single nucleotide polymorphism (SNP). |
OTI Annotation | This TrueClone is provided through our Custom Cloning Process that includes sub-cloning into OriGene's pCMV6 vector and full sequencing to provide a non-variant match to the expected reference without frameshifts, and is delivered as lyophilized plasmid DNA. |
Product Components | The ORF clone is ion-exchange column purified and shipped in a 2D barcoded Matrix tube containing 10ug of transfection-ready, dried plasmid DNA (reconstitute with 100 ul of water). |
Reconstitution | 1. Centrifuge at 5,000xg for 5min. 2. Carefully open the tube and add 100ul of sterile water to dissolve the DNA. 3. Close the tube and incubate for 10 minutes at room temperature. 4. Briefly vortex the tube and then do a quick spin (less than 5000xg) to concentrate the liquid at the bottom. 5. Store the suspended plasmid at -20°C. The DNA is stable for at least one year from date of shipping when stored at -20°C. |
Reference Data | |
RefSeq | NM_206814.2, NP_996537.2 |
RefSeq Size | 2257 bp |
RefSeq ORF | 516 bp |
Locus ID | 4340 |
UniProt ID | Q16653 |
Protein Families | Transmembrane |
Gene Summary | The product of this gene is a membrane protein expressed on the oligodendrocyte cell surface and the outermost surface of myelin sheaths. Due to this localization, it is a primary target antigen involved in immune-mediated demyelination. This protein may be involved in completion and maintenance of the myelin sheath and in cell-cell communication. Alternatively spliced transcript variants encoding different isoforms have been identified. [provided by RefSeq, Jul 2008] Transcript Variant: This variant (alpha5) lacks an alternate in-frame exon in the 5' coding region and differs in the 3' coding region and 3' UTR, compared to variant beta1. The encoded isoform (alpha5) has a distinct C-terminus and is shorter than isoform beta1. |
Documents
Product Manuals |
FAQs |
SDS |
Resources
Other Versions
SKU | Description | Size | Price |
---|---|---|---|
RC225170 | MOG (Myc-DDK-tagged)-Human myelin oligodendrocyte glycoprotein (MOG), transcript variant alpha5 |
CNY 3,990.00 |
|
RC225170L3 | Lenti-ORF clone of MOG (Myc-DDK-tagged)-Human myelin oligodendrocyte glycoprotein (MOG), transcript variant alpha5 |
CNY 5,890.00 |
|
RC225170L4 | Lenti-ORF clone of MOG (mGFP-tagged)-Human myelin oligodendrocyte glycoprotein (MOG), transcript variant alpha5 |
CNY 5,890.00 |
|
RG225170 | MOG (tGFP-tagged) - Human myelin oligodendrocyte glycoprotein (MOG), transcript variant alpha5 |
CNY 4,370.00 |